We narrowed to 15,934 results for: jun
-
Plasmid#220154PurposeTo track the natural FlhD promoter's transcriptional dynamicsDepositorInsertFlhD promoter only
ExpressionBacterialAvailable sinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Fnr-GFP
Plasmid#220155PurposeTo track the natural Fnr promoter's transcriptional dynamicsDepositorInsertFnr promoter only
ExpressionBacterialAvailable sinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
PhoP-GFP
Plasmid#220164PurposeTo track the natural PhoP promoter's transcriptional dynamicsDepositorInsertPhoP promoter only
ExpressionBacterialAvailable sinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
NarL-GFP
Plasmid#220160PurposeTo track the natural NarL promoter's transcriptional dynamicsDepositorInsertNarL promoter only
ExpressionBacterialAvailable sinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIVEX2.3-Theo-3c-EGFP
Plasmid#217526PurposeTheo-3c riboswitch-regulated GFP reporter. The gene is inserted into downstream of T7 promoter.DepositorInsertTheo-3c riboswitch-regulated EGFP
UseIn vitro transcription-translationPromoterT7Available sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-N-PrLD
Plasmid#216397PurposeExpresses 6xHis-tagged N-terminal prion-like domains of Efg1DepositorInsertEfg1-N-PrLD
Tags6xHis-tagsExpressionBacterialMutationdeleted amino acids 182-554Available sinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pR008_APAD
Plasmid#204818PurposeExpression Apobec1-ADAR2dd fusion protein as PIE-RBP controlDepositorInsertrat Apobec1 and human ADAR2 deaminase domain with engineered sites (Apobec1 Rat)
TagsHA and Flag and huADAR2ddExpressionMammalianPromoterchicken β-actin promoterAvailable sinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG/ATP10D(E215Q)-HA
Plasmid#209248PurposeMammalian expression of ATP10D mutant E215QDepositorAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMJ127: pRS426-His-MBP-NlovFz2_PSP1
Plasmid#205257PurposeS. cerevisiae expression vector for NlovFz2 reprogrammed guide (targeting PSP1)DepositorInsertNlovFz2
Tags10xHis, MBPExpressionYeastAvailable sinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBLlSh2
Plasmid#170981PurposeExpression of ShCAST under control of lacI Plac promoter/repressor pair.DepositorInsertslacI
ShTnsB, ShTnsC, ShTniQ, ShCas12k
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterpLlac01Available sinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-fullef1a-mutFAKSPARK2
Plasmid#195266Purposeexpress Tyr to Phe mutant FAKSPARK2 in a lenti vectorDepositorInsertTyr to Phe mutant FAKSPARK2 sensor
UseLentiviralExpressionMammalianPromoteref1aAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT-ChemoC
Plasmid#193809PurposeCMV overexpression of ChemoC in mammalian cell linesDepositorInsertChemoC
Tags10xHisExpressionMammalianMutationmCerulean3:T225R; HT7: E143R, E147R, L271EPromoterCMVAvailable sinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rtn4a-NTD1-135-mNeon
Plasmid#186609PurposeEncodes Reticulon 4 N-terminal domain aa 1 to 135 fused to mNeonGreenDepositorInsertHuman Reticulon 4 isoform A amino acids 1 to 135 (RTN4 Human)
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rtn2b-mNeon
Plasmid#186598PurposeEncodes human full-length Reticulon 2 isoform B fused to mNeonGreenDepositorAvailable sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mNeurog2 gRNA_1-MS2-Puro
Plasmid#192680PurposeLentiviral expression of sgRNA targeting mIL1RN promoter to activate mouse Neurog2 transcriptionDepositorInsertMouse Neurog2 activating gRNA #1 (Neurog2 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_1-MS2-Puro
Plasmid#192673PurposeLentiviral expression of sgRNA targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNA #1 (MYOD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only