We narrowed to 46,691 results for: cha
-
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-PGK-Puro
Plasmid#110859PurposeLentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_P298L_S285C
Plasmid#104469Purposeexpress His tagged P298L S285C hnRNPA2 LCDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-P2A-Puro
Plasmid#110848PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
FRT3-Mb2-HA-mTfp1-2A (IG155)
Plasmid#99621PurposeTo clone gene of interest downstream of FRT3-Mb2-HA-mTfp1-2ADepositorInsertMb2-HA-mTfp1
ExpressionMammalianAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT1-Mb2YFP-2A (IG153)
Plasmid#99619PurposeTo clone gene of interest downstream of FRT1-Mb2YFP-2A cassetteDepositorInsertMb2EYFP
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT2-Mb2Tomato-2A (IG154)
Plasmid#99620PurposeTo clone gene of interest downstream of FRT2-Mb2Tomato-2A cassetteDepositorInsertMb2Tomato
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT3-HA-H2B-Cerulean-2A (IG158))
Plasmid#99624PurposeTo clone gene of interest downstream of FRT3-HA-H2B-Cerulean-2A cassetteDepositorInsertHA-H2B-Cerulean
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-P2A-Puro
Plasmid#110852PurposeLentiviral vector for constitutive expression of Cas9-VRERRA in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRPM7 gRNA (BRDN0001145424)
Plasmid#76113Purpose3rd generation lentiviral gRNA plasmid targeting human TRPM7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pN1_FKBP-HsKIF1C(886-1103)-mCh
Plasmid#253322Purposemammalian expression of the IDR domain (aa 886-1103) of HsKIF1C tagged with FKBP and mCherry. The FKBP tag enables rapamycin-induced attachment to FRB-tagged proteins.DepositorAvailable SinceMarch 30, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pN1_FKBP-mCh-FTH1
Plasmid#253323Purposemammalian expression of human FTH1 tagged with FKBP and mCherry. FTH1 self-assembles into a 24-merparticle. FKBP enables rapamycin-induced attachment to FRB-tagged proteins.DepositorAvailable SinceMarch 30, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pN1_FKBP-HsKIF1C(349-1103)-mCh
Plasmid#253321Purposemammalian expression of the stalk+tail domains (aa 349-1103) of HsKIF1C tagged with FKBP and mCherry. The FKBP tag enables rapamycin-induced attachment to FRB-tagged proteins.DepositorAvailable SinceMarch 30, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pN1_HsKIF1C(1-376)-NC-LZ-TagBFP-FRB
Plasmid#253326Purposemammalian expression of the motor domain of human KIF1C tagged with TagBFP and FRB. NC and LZ facilitate stable dimerization. FRB enables rapamycin-induced attachment to FKBP-tagged proteins.DepositorAvailable SinceMarch 30, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-eGFP-HSV
Plasmid#242769PurposeAAV transfer plasmid expressing eGFP-HSV under a CAG promoter.DepositorInsertEGFP
UseAAVTagsHSVPromoterCAGAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-T7
Plasmid#242778PurposeAAV transfer plasmid expressing eGFP-T7 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsT7PromoterCAGAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
GFP-cCGNL1-HA
Plasmid#236517PurposeFor expression of Paracingulin (dog) in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-mCGNL1
Plasmid#236519PurposeFor expression of Paracingulin (mouse) in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only