We narrowed to 8,830 results for: sgRNA
-
Plasmid#135094PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IVDepositorInsertsgRNA for cxTi10082 (actgttggatgcctgtgtag)
UseCRISPRExpressionWormPromoterU6Available SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
KA2963_eSpCas9-PGKHygdtkCh
Plasmid#124205PurposeExpression of eSpCas9(1.1) and sgRNADepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF704
Plasmid#121658PurposeU6-sgRNA EFS-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralPromoterU6Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF712
Plasmid#121663PurposeU6-sgRNA EF1a-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralPromoterU6Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC-CRISPR-compact
Plasmid#99369PurposeExpresses Cas9-Nlux and sgRNA. Contains CEN/ARS. No selection marker.DepositorTypeEmpty backboneUseAlgae, nannochloropsis expressionTagsCas9-NluxPromoterRibi promoterAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0075
Plasmid#117642PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for SaCas9(pEPOR1CB0015) and sgRNA_Flavin-binding monooxygenase family protein {AT1G62600}(pEPOR1CB0098)and sgRNA_Flavin-binding monooxygenase family protein {AT1G62590}(pEPOR1CB0109)DepositorInsert[35S:SaCas9(pEPOR1CB0015) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR1323
Plasmid#111125PurposeExpresses non-targeting_01224 sgRNA in pCR1068DepositorInsertNon-targeting gRNA
UseLentiviralAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN220
Plasmid#91681PurposeExpress sgRNA targeting human VRK2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN221
Plasmid#91682PurposeExpress sgRNA targeting human VRK2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN154
Plasmid#91683PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas59
Plasmid#82396PurposesgRNA targeting YFP +787 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas45
Plasmid#82390PurposesgRNA targeting YFP with additional bases 5' end like pCas34, but from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas57
Plasmid#82395PurposesgRNA targeting YFP +111 from TSS; template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas56
Plasmid#82394PurposesgRNA targeting YFP +46 from TSS; template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas55
Plasmid#82393PurposesgRNA targeting YFP +172 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas52
Plasmid#82392PurposesgRNA targeting YFP +52 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas39
Plasmid#82389PurposesgRNA targeting glnA expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas36
Plasmid#82388PurposesgRNA targeting ccmK expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas35
Plasmid#82387PurposesgRNA targeting cpcB expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only