We narrowed to 10,071 results for: CAG
-
Plasmid#254712PurposeYeast CRISPR-Cas9 backbone with sgRNA cassette for rapid PCR-based guide insertion; KanMX/G418 selection in S. cerevisiae, Amp/Kan propagation in E. coli.DepositorAvailable sinceAug. 18, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pTol1-U6abc_cmlc2(myl7)_cmlc2-nmKate
Plasmid#238374PurposeDrives expression of 3 different gRNAs targeting cmlc2 (myl7), and expression of nuclear mKate in cardiomyocytes.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnuclear mKate/3 gRNAs targeting cmlc2
Promotercmlc2 (nmKate); U6 (gRNAs)Available sinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
RB1-TP53-LRG-GFP
Plasmid#225876PurposeGuides targeting TP53 and RB1DepositorAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHeCAHS-mEGFP-NLS
Plasmid#205014PurposeThe vector contains 1kbp of the upstream and downstream regions of the chas gene (BV898_02951, CAHS 86272) from Hypsibius exemplaris, with the mEGFP gene with NLS sequence positioned in between.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the chas gene from H. exemplaris
UseTardigrade expressionAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRvUBC-mEGFP-NLS
Plasmid#205010PurposeThe vector contains 1kbp of the upstream and downstream regions of the ubiquitin c gene from Ramazzottius varieornatus, with the mEGFP gene with NLS sequence positioned in between.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the ubiquitin c gene from R. varieornatus
UseTardigrade expressionAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: ATCAGTGATAGAGAACGTATGAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nprl2-g2)-PGKpuroBFP-W
Plasmid#105038PurposeLentiviral gRNA plasmid targeting mouse Nprl2 , co-expression of TagBFPDepositorAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-MRPsg2
Plasmid#87190Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman MRP RNA CRISPR guide #2 (RMRP Human)
UseCRISPRExpressionMammalianPromoterhuman U6Available sinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
MARK2 gRNA (BRDN0001146902)
Plasmid#77592Purpose3rd generation lentiviral gRNA plasmid targeting human MARK2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATR gRNA (BRDN0001145195)
Plasmid#77550Purpose3rd generation lentiviral gRNA plasmid targeting human ATRDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK2A gRNA (BRDN0001162256)
Plasmid#76929Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA3 gRNA (BRDN0001147883)
Plasmid#76743Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA3DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCLK1 gRNA (BRDN0001145902)
Plasmid#76746Purpose3rd generation lentiviral gRNA plasmid targeting human DCLK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK1A gRNA (BRDN0001148321)
Plasmid#76754Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK1ADepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K3 gRNA (BRDN0001147291)
Plasmid#76379Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K3DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K3 gRNA (BRDN0001146677)
Plasmid#76380Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K3DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MINK1 gRNA (BRDN0001146260)
Plasmid#76260Purpose3rd generation lentiviral gRNA plasmid targeting human MINK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP4K4 gRNA (BRDN0001146036)
Plasmid#76265Purpose3rd generation lentiviral gRNA plasmid targeting human MAP4K4DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP4K4 gRNA (BRDN0001162353)
Plasmid#76266Purpose3rd generation lentiviral gRNA plasmid targeting human MAP4K4DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only