We narrowed to 580 results for: cas9 f cas9 r
-
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAi14-GFPNLS-MC
Plasmid#87114Purposeminicircle parental backbone plasmid including GFPNLS-pA knock-in donor and one cutting site for HITIDepositorInsertGFPNLSPpA
UseCRISPRPromoternEFAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mTubb3
Plasmid#87116PurposeAAV backbone plasmid including GFP knock-in donor and Tubb3gRNA for HITIDepositorInsertU6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA
UseAAV and CRISPRAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAi14-luc-MC
Plasmid#87113Purposeminicircle parental backbone plasmid including luc-pA knock-in donor and one cutting site for HITIDepositorInsertLuciferase-SV40pA
UseCRISPR and LuciferaseAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-HITI
Plasmid#87117PurposeAAV backbone plasmid including GFPNLS-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-GFPNLS-EF1a-mCherryKASH-pA
UseAAV and CRISPRAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tubb3gRNA-mCherry
Plasmid#87111Purposemouse Tubb3 target gRNA expression plasmid with CAGmCherryDepositorInsertMouse Tubb3 gRNA
UseCRISPRPromoterCAGAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-luc
Plasmid#87118PurposeAAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
UseAAV, CRISPR, and LuciferaseAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60228PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA control targeting LacZ. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60229PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60227PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA targeting the mouse gene NeuN. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only