We narrowed to 10,837 results for: yeast
-
Plasmid#91812PurposeYeast expression of S. cerevisiae Rpb1 with a T1471A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged threonine 1471 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3511 (YCp LEU2 Rpb1 P1472A)
Plasmid#91813PurposeYeast expression of S. cerevisiae Rpb1 with a P1472A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged proline 1472 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS313-PRP8
Plasmid#90964Purposeyeast vectorDepositorAvailable sinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
GGE094
Plasmid#120787PurposePart of GoldenGate Yarrowia lipolytica toolkit for assembling an expression plasmid for Y. lipolytic yeast. Sequence for integration into Y. lipolytica genome, randomly or at zeta platforms. Linearization of cassette by SfiI restriction enzyme after the assemblyDepositorInsertInsDown_Zeta-SfiI
UseCloning/assembly plasmidAvailable sinceNov. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
GGE091
Plasmid#120786PurposePart of GoldenGate Yarrowia lipolytica toolkit for assembling an expression plasmid for Y. lipolytic yeast. Sequence for integration into Y. lipolytica genome, randomly or at zeta platforms. Linearization of cassette by SfiI restriction enzyme after the assemblyDepositorInsertInsUp_Zeta-SfiI
UseCloning/assembly plasmidAvailable sinceNov. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAD-Atg17
Plasmid#121386PurposeFor Yeast-two-hybrid analysisDepositorInsertATG17
ExpressionYeastPromoterADH1 promoterAvailable sinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHCas9-Nours
Plasmid#107733PurposeEscherichia coli- S. cerevisiae shuttle plasmid harbors a Cas9 gene, a natMX6 and URA3 selection markers used in S. cerevisiaeDepositorInsertCas9
UseCRISPRTagsSV40 NLSExpressionYeastMutationHuman optimizedPromoterTEF1Available sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs_FLAG-FSF1
Plasmid#110641PurposeRetroviral expression of flag-tagged yeast FSF1 in mammalian cellsDepositorInsertFSF1 (FSF1 Budding Yeast)
UseRetroviralTagsFLAGExpressionMammalianMutationcodon-optimized cDNA (no amino acid mutations)Available sinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PP275
Plasmid#78968PurposePromoter: GAP, minimal Promoter: GCW14. Figure 4. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
PP161
Plasmid#78993PurposeSupplemental Figure 4. Promoter GAP3. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
PP363
Plasmid#78984Purpose255B. Promoter: scTEF1, minimal Promoter: GAP. Figure 5. Expresses rHGH and IFNa2b.DepositorInsertsrHGH
IFNa2b
ExpressionYeastAvailable sinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
PP164
Plasmid#78988PurposeSupplemental Figure 4. Promoter short ppTEF1. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PP149
Plasmid#78989PurposeSupplemental Figure 4. Promoter WT GAP. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
PP154
Plasmid#78991PurposeSupplemental Figure 4. Promoter GAP1. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
PP162
Plasmid#78995PurposeSupplemental Figure 4. Promoter GAP5. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PP324
Plasmid#78982Purpose246B. Promoter: GAP6, minimal Promoter: AOX1. Figure 5. Expresses rHGH and IFNa2b.DepositorInsertsrHGH
IFNa2b
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
PP246
Plasmid#78966PurposePromoter: GAP6, minimal Promoter: AOX1. Figure 4. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2374
Plasmid#67534PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked KlURA3 marker, integration into S. cerevisiae XI-1 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable sinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJW3.42
Plasmid#62866PurposeYeast two-hybrid bait vector expressing LexA-PPTR-1 fusionDepositorInsertPPTR-1/pLexA-N bait
UseTwo-hybrid bait vectorTagsLexAExpressionYeastAvailable sinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only