We narrowed to 14,379 results for: Cre
-
Plasmid#169182PurposeBaculoviral transfer vector to express nsp12-His6-3xFlag (SARS-CoV-2) in insect cellsDepositorInsertnsp12-His6-3xFlag (ORF1ab Synthetic, SARS-CoV-2)
TagsHis6-3xFlagExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCC_06 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dCas9NG-NLS-VPR-2A-Puro-WPRE
Plasmid#139091PurposeExpresses human codon-optimized inactive SpCas9-NG fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdSpCas9-NG-VPR
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, L1111R, D1135V,G1218R, E1219F, A1322…Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
BAP1-wt (siRNA resistant)
Plasmid#108439PurposeStable expression of BAP1-wt in mammalian cells, gene has an introduced siRNA-resistance against siBAP1.DepositorInsertBAP1 (BAP1 Human)
ExpressionMammalianMutationc.1641C>T, c.1644T>A, c.1647T>C, c.1650C…PromoterCMVAvailable sinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Ataxin3-Strep-HA
Plasmid#113496PurposeExpression of human Ataxin-3 with C-terminal strep-HA tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAtaxin-3 (ATXN3 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable sinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA5FRT/TO-DVC1-Strep-HA
Plasmid#113481PurposeExpression of human DVC1 with C-terminal strep-HA tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDVC1 (SPRTN Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable sinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-myc3-Mdm2 D367E
Plasmid#52057Purposeexpression of non-cleavable Mdm2 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMdm2 D367E (MDM2 Human)
Tagsmyc3ExpressionMammalianMutationD367EPromoterCMVAvailable sinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
nes1852tk/lacZ
Plasmid#47613Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnestin 2nd intron (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation2nd intron onlyPromoterHSV tk promoterAvailable sinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMV-68_HNF4A2
Plasmid#31092DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 2 of HNF4A, deletion of CMV promo…Available sinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
IFNAR2_pcDNA6.2/EmGFP-Bsd
Plasmid#176938PurposeMammalian expression vector encoding IFNAR2 and EmGFP-BsdDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIFNAR2 (IFNAR2 Human)
ExpressionMammalianPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRibo-Sec-APEX2m
Plasmid#176844PurposeExpression of APEX2 in the periplasm from a codon-optimized gene (multi-copy episomal plasmid)DepositorInsertpRibo-Sec-APEX2m
UseInducibleExpressionBacterialPromoterpRibo, theophilline riboswitch inducible hsp60 pr…Available sinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
HisGB1-Hif1a(776-826) + CBP TAZ1(340-439)
Plasmid#99343PurposeBacterial expression of mouse CBP TAZ1 domain as coexpression with Hif1a TADDepositorAvailable sinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
BACE2_pcDNA6.2/EmGFP-Bsd
Plasmid#176942PurposeMammalian expression vector encoding BACE2 and EmGFP-BsdDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBACE2 (BACE2 Human)
ExpressionMammalianPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
EBA140-bio
Plasmid#47742PurposeExpresses enzymatically monobiotinylated full-length EBA140 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCodon-optimised EBA140
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PTEX150-bio
Plasmid#47788PurposeExpresses enzymatically monobiotinylated full-length PTEX150 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCodon-optimised PTEX150
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
GNAS_pcDNA6.2/EmGFP-Bsd
Plasmid#176976PurposeMammalian expression vector encoding GNAS and EmGFP-BsdDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGNAS (GNAS Human)
ExpressionMammalianPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTomatoSlicer
Plasmid#221085PurposeDual-color splicing reporter expressing eGFP and tdTomato from the CMV early enhancer/chicken ß-actin (CAGGS) promoter.DepositorTypeEmpty backboneExpressionMammalianAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PJEBAN4
Plasmid#203683PurposeExpresses red fluorescent marker HcRed in Listeria monocytogenesDepositorInsertHcRed
ExpressionBacterialAvailable sinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC026
Plasmid#227598PurposeLentiviral backbone used when cloning pooled prime editing guide RNA libraries that do not already contain a tevopreQ1 RNA motif (backbone contains motif)DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-CT3G-CERP2
Plasmid#175499PurposeAll-in-one piggyBac transposon vector for mCMV+dox-inducible expression of Golden Gate cloned elements (CMVe-hEF1a-driven rtTA and puromycin resistance)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterTRE3G-mCMVAvailable sinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only