We narrowed to 33,703 results for: PLE
-
Plasmid#240789PurposePlasmid contains the triple selection cassette gfp -RK2 tetARK2 - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA RK2 His medium : T7- His tags medium- gfp -RK2 tetARK2 - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA039
Plasmid#240788PurposePlasmid contains the triple selection cassette gfp -RK2 tetARK2 - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA RK2 His low : T7- His tags low - gfp -RK2 tetARK2 - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO539
Plasmid#235752PurposeProtein expression of ScVPS30 and ScVPS38DepositorAvailable SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
T7pro-tRNA-ITSIle intron-T7tVar1-pRS426
Plasmid#239294PurposeExpresses the tRNAIle intron bearing the 5' GGGAGA initially transcribed sequence (ITS); Plasmid #2 of the tet-on overexpression systemDepositorInsertsT7 promoter
ITS-tRNAIle intron
T7 terminator - Var1
ExpressionYeastAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO734
Plasmid#235753PurposeProtein expression of ScVPS30 and ZZ-ScVPS38DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28Man
Plasmid#203399Purposeexo-beta mannosidase useful in enzymatic biotransformations of glycans and in coupled assays of various carbohydrate processing enzymesDepositorInsertman2A
TagsH6ExpressionBacterialMutationNonePromoterT7Available SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMamCol1
Plasmid#215184PurposeAllows for stable expression of recombinant (tagged/untagged) proteins in AAVS1 locus of Human cells and transient Protein Expression in E. coliDepositorInserttsPurple
UseAAV, CRISPR, and Synthetic Biology ; Recombinant …TagsSNAC-StrepII tagExpressionBacterial and MammalianPromoterTetON 3G Bidirectional for Mammalian and Trc with…Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a_DIO_HA/FLAG_muMASS
Plasmid#213393PurposeuMASS_1 opioid sensor. AAV Virus production for Cre dependent expressionDepositorInsertuMASS_1
UseAAV and Cre/LoxExpressionMammalianAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-dMASS_1_WPRE
Plasmid#209765PurposeAAV virus production for neuronal expression of dMASS_1 under hSyn promoterDepositorInsertdMASS_1
UseAAVExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS02060_pMQ30_KO_Kan
Plasmid#185391PurposeNon-replicating vector used to create markerless deletion of RR42_RS02060 in C. basilensis 4G11DepositorInsertsRR42_RS02060 upstream flanking homology region
RR42_RS02060 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS28935_pMQ30_KO_Kan
Plasmid#185392PurposeNon-replicating vector used to create markerless deletion of RR42_RS28935 in C. basilensis 4G11DepositorInsertsRR42_RS28935 upstream flanking homology region
RR42_RS28935 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS18965_pMQ30_KO_Kan
Plasmid#185394PurposeNon-replicating vector used to create markerless deletion of RR42_RS18965 in C. basilensis 4G11DepositorInsertsRR42_RS18965 upstream flanking homology region
RR42_RS18965 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS18970_pMQ30_KO_Kan
Plasmid#185395PurposeNon-replicating vector used to create markerless deletion of RR42_RS18970 in C. basilensis 4G11DepositorInsertsRR42_RS18970 upstream flanking homology region
RR42_RS18970 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-Llgl1-WPRE-UbC-Emerald
Plasmid#203805PurposeLentiviral vector plasmid expressing mouse Llgl1 under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-ATG101
Plasmid#189590PurposeTo make ATG101/ATG13 HORMA complexDepositorAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-RanGAP
Plasmid#175235PurposeBacterial expression and purification, high affinity SUMOylation substrateDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only