We narrowed to 44,255 results for: gats

#224484

Gateway compatible middle entry clone containing V5 tagged mTagBFP2 (Cytosolic blue fluorescent reporter)

Joshua Wythe

Gillespie WB et al Development. 2025 Nov 15;152(22):dev2043

Sept. 30, 2024

Academic Institutions and Nonprofits only

#224529

A Gateway compatible 3' entry clone containing an V5 mScarlet fusion followed by SV40 late polyA

Joshua Wythe

Gillespie WB et al Development. 2025 Nov 15;152(22):dev2043

Sept. 26, 2024

Academic Institutions and Nonprofits only

#109584

Multisite gateway vector for 3' tagging with dominant negative CDC42

Rob Parton

Hall et al Nat Commun. 2020 Jul 24;11(1):3711. doi:

Feb. 27, 2020

Academic Institutions and Nonprofits only

#109342

Lenti-viral expression of Flag-tagged Depdc5 mutant P

David Sabatini, Kuang Shen

Shen et al Nature. 2018 Apr 5;556(7699):64-69. doi:

July 24, 2018

Academic Institutions and Nonprofits only

#166844

Expresses Peroxisome localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 390 base pairs from the PEX14 ORF

Daniel Klionsky

Gatica et al Autophagy. 2020 Jun 8. doi: 10.1080/1554

April 2, 2021

Academic Institutions and Nonprofits only

#166843

Expresses ER localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.

Daniel Klionsky

Gatica et al Autophagy. 2020 Jun 8. doi: 10.1080/1554

April 2, 2021

Academic Institutions and Nonprofits only

#109346

Lenti-viral expression of HA-tagged Depdc5 mutant AB

David Sabatini, Kuang Shen

Shen et al Nature. 2018 Apr 5;556(7699):64-69. doi:

July 24, 2018

Academic Institutions and Nonprofits only

#91182

T-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)

Daniel Voytas

Cermak et al Plant Cell. 2017 May 18. pii: tpc.00922.

Sept. 29, 2017

Academic Institutions and Nonprofits only

#177370

Trigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.

Jerome Bonnet, Jean-Loup Faulon

Batista et al ACS Synth Biol. 2022 Jan 16. doi: 10.102

Jan. 26, 2022

Academic Institutions and Nonprofits only

#109341

Lenti-viral expression of Flag-tagged Depdc5 mutant AB

David Sabatini, Kuang Shen

Shen et al Nature. 2018 Apr 5;556(7699):64-69. doi:

July 24, 2018

Academic Institutions and Nonprofits only