We narrowed to 15,901 results for: grna
-
Plasmid#165459PurposeEscherichia coli – Staphylococcus aureus shuttle vector for plasmid curing in Gram-positive bacteriaDepositorInsertsgRNA2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterSP01Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA1.1
Plasmid#64116PurposeVector for expression of St1 sgRNA1.1 in mammalian cellsDepositorInsertSt1 sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-Dual: Combinatorial RfxCas13d gRNA and array cloning backbone
Plasmid#228362PurposemU6- and hU6-driven expression of dual RfxCas13d gRNAs and arrays for combinatorial RNA knockdown.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromotermU6 and hU6Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi-v2, Gene Expression (h5), top 5 sgRNAs/gene
Pooled Library#83975PurposeHuman CRISPRi Pooled Library targeting gene expressionDepositorAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEn-Chimera
Plasmid#61432PurposeGateway-Entry vector containing AtU6-26 promoter and sgRNA backboneDepositorInsertAtU6-26:sgRNA
UseCRISPRExpressionPlantPromoterAtU6-26Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Suv39H1_1
Plasmid#36342DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRetrosuper USP28 shRNA-1
Plasmid#15663DepositorAvailable SinceNov. 2, 2007AvailabilityIndustry, Academic Institutions, and Nonprofits -
MDH1-miR-30-PGK-GFP
Plasmid#11379DepositorInsertmiR-30
UseRNAi and RetroviralExpressionMammalianAvailable SinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Blasto
Plasmid#167904PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK10 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitURA3,AmpR)
Plasmid#178994PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitURA3DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK08 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitLEU2,AmpR)
Plasmid#178992PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitLEU2DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-ROSA26_hspCas9
Plasmid#193310PurposeCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M9-IRES-CFP
Plasmid#114731PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M9
UseCRISPRExpressionMammalianAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 1
Plasmid#70659PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -296
Plasmid#50926PurposeU6 driven sgRNA targeting Sox17 -296 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Cancer and Apoptosis (h2), top 5 sgRNAs/gene
Pooled Library#83981PurposeHuman CRISPRa Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pepper-fused sgRNA
Plasmid#217520PurposeExpresses Pepper-fused sgRNA in mammalian cells with U6 promoterDepositorInsertPepper-fused sgRNA for spCas9
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDT-sgRNA-XMAS-1x
Plasmid#164413PurposeDual targeted guide and cloning vector. Targets pEF-XMAS-1xStop. Guides targeting endogenous sites can be cloned into BbsI sites.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only