We narrowed to 16,105 results for: grna
-
Plasmid#26626DepositorAvailable sinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only
-
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Cerulean-zhang2.0 Weiss full
Plasmid#79383PurposeCas9 gRNA variant to recruit ms2 proteinsDepositorInsertZhang 2.0 + scaffold
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-ALB_DF_B358c_attB
Plasmid#182146PurposeTo insert attB attachment site at ALB in human cells via twinPEDepositorInsertALB_B358c_attB pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-ALB_DF_A277c_attB
Plasmid#182145PurposeTo insert attB attachment site at ALB in human cells via twinPEDepositorInsertAlb_A277c_attB pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMPTY::sgRNA2
Plasmid#165459PurposeEscherichia coli – Staphylococcus aureus shuttle vector for plasmid curing in Gram-positive bacteriaDepositorInsertsgRNA2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterSP01Available sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA1.1
Plasmid#64116PurposeVector for expression of St1 sgRNA1.1 in mammalian cellsDepositorInsertSt1 sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-Dual: Combinatorial RfxCas13d gRNA and array cloning backbone
Plasmid#228362PurposemU6- and hU6-driven expression of dual RfxCas13d gRNAs and arrays for combinatorial RNA knockdown.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromotermU6 and hU6Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shRen.713
Plasmid#186712PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Non-targeting control shRNA (shRen.713).DepositorInsertshRen.713
UseLentiviral and RNAiExpressionMammalianAvailable sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR v2-sgSLC7A11/xCT-1
Plasmid#161818Purposeknock out SLC7A11/xCT in mammalian cellsDepositorInsertSLC7A11 solute carrier family 7 member 11 xCT (SLC7A11 Human)
UseCRISPR and LentiviralAvailable sinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDA_118
Plasmid#133459PurposeU6 promoter expresses customizable Spyo-guide; EF1a promoter provides puromycin resistance. This vector is a derivative of the lentiGuide vector, with minor modifications to the tracrRDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PTEN shRNA
Plasmid#86645Purposeexpression of shRNA targeting PTENDepositorPublicationAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSicoR human Dicer3
Plasmid#14765DepositorAvailable sinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSico Dnmt1
Plasmid#12165PurposeCre-regulated lentiviral shRNA vector. Cre addition causes EGFP to be recombined out of the construct, activating Dnmt1 shRNA expression.DepositorInsertDnmt1 shRNA (Dnmt1 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available sinceJune 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBBK10 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitURA3,AmpR)
Plasmid#178994PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitURA3DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK08 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitLEU2,AmpR)
Plasmid#178992PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitLEU2DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Blasto
Plasmid#167904PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX459_gRNA-ROSA26_hspCas9
Plasmid#193310PurposeCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M9-IRES-CFP
Plasmid#114731PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M9
UseCRISPRExpressionMammalianAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only