We narrowed to 24,357 results for: c-MYC
-
Plasmid#73872PurposeRet2 (full length)DepositorInsertRet2
ExpressionYeastPromoterMet25Available SinceNov. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSL3 - Brr2 del113 N1104L
Plasmid#90253Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 113 amino acids and amino acid N110…AvailabilityAcademic Institutions and Nonprofits only -
pSL11 - Brr2 del422 N1104L
Plasmid#90261Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 422 amino acids and amino acid N110…AvailabilityAcademic Institutions and Nonprofits only -
pSL12 - Brr2 del422 Q904E
Plasmid#90262Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 422 amino acids and amino acid Q904EAvailabilityAcademic Institutions and Nonprofits only -
pSL13 - Brr2 del422 R1107L
Plasmid#90263Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 422 amino acids and amino acid R110…AvailabilityAcademic Institutions and Nonprofits only -
B52_puro_empty_gRNA
Plasmid#197557Purposesites for cloning two gRNA with puromycin cassetteDepositorTypeEmpty backboneUseEmpty grna backbone with puromycin resistance geneExpressionMammalianPromoterU6 for gRNA, CMV for puromycin resistance.Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEM_Δflv3.sm
Plasmid#185533Purposea pGEM-T easy vector containing the streptomycin/spectinomycin resistance cassette flanked by the two regions for the double homologous recombination on the flv3 locusDepositorInsertaadA gene flanked by flv3 upstream and downstream regions
UseSynthetic BiologyAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBES1-LacOx50-Hyg
Plasmid#210261PurposeIntegrates 50xLacO repeats upstream of the BES1 promoter with a hygromycin drug selection marker downstream of the promoter.DepositorInsert50xLacO repeats derived from: PMID: 12864855.
Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMito-dCherry-FRB
Plasmid#186573PurposeExpression of "dark MitoTrap" - an FRB-domain targeted to the mitochondria that is the same size as pMito-mCherry-FRB but is non-fluorescent - in human cellsDepositorInsertDark MitoTrap
ExpressionMammalianMutationMutation of "K70N" to render mCherry no…PromoterCMVAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAV1-mEGFP
Plasmid#27704DepositorAvailable SinceJuly 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-Z3EV
Plasmid#157659PurposeGFP gene and gRNA under Z3EV expression control (estradiol sensor), with Z3EV transcription factor to insert in the genome.DepositorInsertGFP-gRNA NatMX Z3EV
UseInsert storage (replicative in e. coli)Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-LEU2
Plasmid#157656PurposeGFP and gRNA tag for protein and mRNA quantification, to attache to the 3' end of the gene coding sequenceDepositorInsertGFP-gRNA
UseInsert storage (replicative in e. coli)TagsGFP-gRNAAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Plas-CRISPR_reporter
Plasmid#157658PurposeCRISPR reporter for mRNA quantification, integrative plasmid into NPR2 geneDepositorInsertdCAS9-VP64, mCherry, KanMX
UseInsert storage (replicative in e. coli)MutationN28D in mCherry- please see depositor comments be…Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only