We narrowed to 11,776 results for: Vars

#113972

Single short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequence

Jordan Green

Rui et al Mol Ther Nucleic Acids. 2020 Apr 21;20:6

March 25, 2021

Academic Institutions and Nonprofits only

#113973

Single short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequence

Jordan Green

Rui et al Mol Ther Nucleic Acids. 2020 Apr 21;20:6

March 25, 2021

Academic Institutions and Nonprofits only

#113974

Single short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequence

Jordan Green

Rui et al Mol Ther Nucleic Acids. 2020 Apr 21;20:6

March 25, 2021

Academic Institutions and Nonprofits only

#158965

Wild type VanR where the residue in position 165 was mutated from Phenylalanine to Valine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.

Michael Jensen

et al Biotechnology Notes, Volume 1, 2020, Pag

Jan. 8, 2021

Academic Institutions and Nonprofits only

#158966

Wild type VanR where the residue in position 165 was mutated from Phenylalanine to Arginine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.

Michael Jensen

et al Biotechnology Notes, Volume 1, 2020, Pag

Jan. 8, 2021

Academic Institutions and Nonprofits only

#159883

Golden Gate compatible intron with no PATCs for negative controls

Christian Froekjaer-Jensen

Aljohani et al Nat Commun. 2020 Dec 9;11(1):6300. doi:

Dec. 17, 2020

Academic Institutions and Nonprofits only

#159884

Golden Gate compatible intron with no PATCs for negative controls

Christian Froekjaer-Jensen

Aljohani et al Nat Commun. 2020 Dec 9;11(1):6300. doi:

Dec. 17, 2020

Academic Institutions and Nonprofits only

#159885

Golden Gate compatible intron with no PATCs for negative controls

Christian Froekjaer-Jensen

Aljohani et al Nat Commun. 2020 Dec 9;11(1):6300. doi:

Dec. 17, 2020

Academic Institutions and Nonprofits only

#113966

Single short guide RNA targeting GTATAGCATACATTATACG

Jordan Green

Rui et al Mol Ther Nucleic Acids. 2020 Apr 21;20:6

May 28, 2020

Academic Institutions and Nonprofits only

#138974

Light-induced recruitment of NSImb-QPAS1-mCherry to the target protein bound to membrane; interaction occurs via intrabody fused to BphP1

Vladislav Verkhusha

Redchuk et al Nat Commun. 2020 Jan 30;11(1):605. doi:

April 23, 2020

Academic Institutions and Nonprofits only