We narrowed to 18,195 results for: puro
-
Plasmid#77770Purpose3rd generation lentiviral gRNA plasmid targeting human IKBKEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
IKBKE gRNA (BRDN0001144791)
Plasmid#77772Purpose3rd generation lentiviral gRNA plasmid targeting human IKBKEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
DAPK1 gRNA (BRDN0001146680)
Plasmid#76518Purpose3rd generation lentiviral gRNA plasmid targeting human DAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK9 gRNA (BRDN0001147698)
Plasmid#76718Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IRAK4 gRNA (BRDN0001146161)
Plasmid#75664Purpose3rd generation lentiviral gRNA plasmid targeting human IRAK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GNE gRNA (BRDN0001149237)
Plasmid#77833Purpose3rd generation lentiviral gRNA plasmid targeting human GNEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TWF1 gRNA (BRDN0001149022)
Plasmid#77287Purpose3rd generation lentiviral gRNA plasmid targeting human TWF1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TWF1 gRNA (BRDN0001147784)
Plasmid#77288Purpose3rd generation lentiviral gRNA plasmid targeting human TWF1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHEK1 gRNA (BRDN0001145520)
Plasmid#76643Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KB2 gRNA (BRDN0001146372)
Plasmid#76057Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KB2 gRNA (BRDN0001146023)
Plasmid#76058Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHEK2 gRNA (BRDN0001146385)
Plasmid#76488Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHEK2 gRNA (BRDN0001145828)
Plasmid#76489Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PEAK1 gRNA (BRDN0001147244)
Plasmid#75854Purpose3rd generation lentiviral gRNA plasmid targeting human PEAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PEAK1 gRNA (BRDN0001147666)
Plasmid#75855Purpose3rd generation lentiviral gRNA plasmid targeting human PEAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FGGY gRNA (BRDN0001145631)
Plasmid#77109Purpose3rd generation lentiviral gRNA plasmid targeting human FGGYDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK2A gRNA (BRDN0001162256)
Plasmid#76929Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATR gRNA (BRDN0001144763)
Plasmid#77549Purpose3rd generation lentiviral gRNA plasmid targeting human ATRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only