We narrowed to 7,809 results for: CCH
-
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Htt(25Q)-c_myc
Plasmid#225228PurposeYeast optimized human Htt (25Q) fused with aga2 protein gene under gal1 promoter for the expression of Htt (25Q) in yeast surface display.DepositorInsertsAga2
Htt (25Q)
TagsHA Tag and c-myc TagExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Htt(46Q)-c_myc
Plasmid#225229PurposeYeast optimized human Htt (46Q) fused with aga2 protein gene under gal1 promoter for the expression of Htt (46Q) in yeast surface display.DepositorInsertsAga2
Htt (46Q)
TagsHA Tag and c-myc TagExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM90
Plasmid#226682PurposeRpn9S111TAG lid (Rpn5, MBP-HRV-Rpn6, Rpn8, Rpn9S111TAG, Rpn11)DepositorInsertsTagsMBP-HRVExpressionBacterialMutationS111TAGAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFB-D3-ASK1
Plasmid#226619PurposeCo-expression of D3 and ASK1 complex in insect cellsDepositorInsertsTagsHis tag followed with three copies of MsybExpressionInsectMutationThe flexible loop in D3 (Q478-D515) can be removeā¦PromoterPolyhedrinAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxamEXP4CUP1
Plasmid#218284PurposeUse together with pJE13HD7 and pJE13HD7 derivatives to integrate RelE expression cassette under the control of the CUP1 promoter at ho locusDepositorInsertHph>tAgTEF1-ISceI-Repeat2-pCUP1>RelE(1-125)>RPL28intron>RelE(126, 289)>tTPI1-HO(1828, 1979)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL43C
Plasmid#218278PurposeIntroduction of a LowTempGAL Turbo module (GAL43C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-pENO2>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL4A
Plasmid#218277PurposeIntroduction of a LowTempGAL Turbo module (GAL4) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-fcy1(454-778)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL3C
Plasmid#218275PurposeIntroduction of a LowTempGAL Turbo module (GAL3C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pENO2>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only