We narrowed to 10,837 results for: yeast
-
Plasmid#90975Purposeyeast vectorDepositorAvailabilityAcademic Institutions and Nonprofits only
-
pRS313 - prp8 V1870N
Plasmid#90976Purposeyeast vectorDepositorAvailabilityAcademic Institutions and Nonprofits only -
pRS313 - prp8 I1875T
Plasmid#90977Purposeyeast vectorDepositorAvailabilityAcademic Institutions and Nonprofits only -
pNK5867
Plasmid#219751PurposepGAP-like vector encoding hispidin-synthase from Mycena citricolor under control of GAP promoter, for yeast expressionDepositorInsertpGAP - mcitHispS - tAOX
ExpressionYeastAvailable sinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK1508
Plasmid#219750PurposepGAP-like vector encoding Aspergillus nidulans 4'-phosphopantetheinyl transferase NpgA under control of GAP promoter, for yeast expressionDepositorInsertpGAP - npgA - tAOX
ExpressionYeastAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYeDP60-hATP13A2-E343A
Plasmid#171378PurposeA modified pYEDP60 plasmid containing a yeast codon-optimized version of human ATP13A2 variant 2 E343A mutant, followed by a thrombin cleavage site and a C-term BAD tag. DOI: 10.21769/BioProtoc.3888DepositorInserthuman ATP13A2 variant 2 wild-type (ATP13A2 Human)
TagsBAD tagExpressionYeastMutationE343APromoterURA3Available sinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
297_pETcon_SARS2_Omicron-BA286
Plasmid#222231Purposeyeast surface display of the SARS-CoV-2 BA.2.86 variant RBDDepositorInsertSARS-CoV-2 BA.2.86 RBD (S SARS-CoV-2 virus, Budding Yeast)
TagsHA and c-MycExpressionYeastAvailable sinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
299_pETcon_SARS2_EG-5
Plasmid#222232Purposeyeast surface display of the SARS-CoV-2 EG.5 variant RBDDepositorAvailable sinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-CUbo(K48R/K63R)-His6
Plasmid#212780PurposeC-terminal PCR-based tagging with CUbo(K48R/K63R)-His6 in budding yeast with HygR selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-CUbo(K48R)-9myc
Plasmid#212787PurposeC-terminal PCR-based tagging with CUbo(K48R)-9myc in budding yeast with HygR selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-CUbo(K63R)-yeGFP
Plasmid#212768PurposeC-terminal PCR-based tagging with CUbo(K63R)-yeGFP in budding yeast with HygR selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-CUbo(K48R/K63R)-yeGFP
Plasmid#212769PurposeC-terminal PCR-based tagging with CUbo(K48R/K63R)-yeGFP in budding yeast with HygR selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-CUbo-yeGFP
Plasmid#212766PurposeC-terminal PCR-based tagging with CUbo-yeGFP in budding yeast with HygR selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-TET-NUbo-E3(48)-NLS-VSV
Plasmid#212746PurposeDoxycycline-inducible expression of NUbo-E3(48)-NLS-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNLS-VSV and NUboExpressionYeastPromoterTetAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-TET-NUbo-E3(63)-NLS-VSV
Plasmid#212756PurposeDoxycycline-inducible expression of NUbo-E3(63)-NLS-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNLS-VSV and NUboExpressionYeastPromoterTetAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-CUbo(K48R)-yeGFP
Plasmid#212767PurposeC-terminal PCR-based tagging with CUbo(K48R)-yeGFP in budding yeast with HygR selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCaUra3-CUbo-yeGFP
Plasmid#212771PurposeC-terminal PCR-based tagging with CUbo-yeGFP in budding yeast with CaUra3 selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only