We narrowed to 8,359 results for: lif
-
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS2-4
Plasmid#184730PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PLA2G4A-1
Plasmid#184735PurposecPLA2-KO in HeLaDepositorInsertA gRNA targeting the human cPLA2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PLA2G4A-2
Plasmid#184736PurposecPLA2-KO in HeLaDepositorInsertA gRNA targeting the human cPLA2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-OptoSTIM1(CRY2clust)
Plasmid#184715PurposeOptoSTIM1(CRY2clust)DepositorInsertOptoSTIM1
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-EBFP2-OptoSTIM1(CRY2clust)
Plasmid#184716PurposeOptoSTIM1(CRY2clust)DepositorInsertOptoSTIM1
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-PTGER2
Plasmid#184721PurposeExogenous EP2DepositorInsertPTGER2 (PTGER2 Human, Synthetic)
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-COX1-4
Plasmid#184722PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-hyg2-COX2-4
Plasmid#184723PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-PTGER2
Plasmid#184724PurposeEP2-KO in MDCKDepositorInsertA gRNA targeting the dog EP2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-PLA2G4A_3
Plasmid#184725PurposecPLA2-KO in MDCKDepositorInsertA gRNA targeting the dog cPLA2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-hyg2-PTGER4
Plasmid#184726PurposeEP4-KO in MDCKDepositorInsertA gRNA targeting the dog EP4 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS1-3
Plasmid#184727PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS1-4
Plasmid#184728PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS2-3
Plasmid#184729PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-UbC-4493NES(Booster-PKA)
Plasmid#184711PurposePKA biosensorDepositorInsertBooster-PKA
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIhyg-iRFP670-P2Av3-RGECO1.0
Plasmid#184713PurposeCalcium biosensorDepositorInsertGCaMP6s
UseLentiviralExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBbA5k-AcrAB-AsLOV2*(543)
Plasmid#210863PurposeIPTG inducible promoter (lacUV5) expressing AcrA and AcrB-AsLOV2*(543). AsLOV2*(543) is also described in the literature as LOVdeg.DepositorInsertsacrA
acrB
UseSynthetic BiologyTagsAsLOV2*(543)Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pOTC-GFP
Plasmid#205724PurposeExpression of GFP fused with pOTC, a leader peptide from mitochondrial matrix enzyme ornithine transcarbamylaseDepositorInsertpOTC-GFP
ExpressionMammalianAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
TaraACR1-pmCherry-C1
Plasmid#204960PurposeExpression of TaraACR1 in fusion with mCherry in mammalian cellsDepositorInsertTaraACR1
TagsmCherryExpressionMammalianPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
TaraACR2-pmCherry-C1
Plasmid#204961PurposeExpression of TaraACR2 in fusion with mCherry in mammalian cellsDepositorInsertTaraACR2
TagsmCherryExpressionMammalianPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
TaraACR3-pmCherry-C1
Plasmid#204962PurposeExpression of TaraACR3 in fusion with mCherry in mammalian cellsDepositorInsertTaraACR3
TagsmCherryExpressionMammalianPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
S16-ACR1-pcDNA3.1-mScarlet
Plasmid#204963PurposeExpression of S16-ACR1 fused to mScarlet in mammalian cellsDepositorInsertS16-ACR1
TagsmScarletExpressionMammalianPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Opto-BMPR2a
Plasmid#207616PurposeZebrafish BMPR2a BMP receptor kinase domain and CTD fused to VfLOVDepositorInsertBMPR2a kinase domain and CTD + VfLOV domain (bmpr2a Zebrafish, Vaucheria frigida)
Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1(#c)
Plasmid#206359PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA of Hsp90ab1 (#c)
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1 (#a)
Plasmid#206357PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA #a of Hsp90ab1
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-jAspSnFR3-mRuby3-NLS
Plasmid#203489PurposeNuclear directed jAspSnFR3-mRuby3 in Gateway cloning entry vectorDepositorInsertjAspSnFR3-mRuby3-NLS
UseGateway entry vectorTagsNuclear localization signal and mRuby3Available SinceAug. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-MTS-jAspSnFR3-mRuby3
Plasmid#203490PurposeMitochondrial directed jAspSnFR3-mRuby3 in Gateway cloning entry vectorDepositorInsertMTS-jAspSnFR3
UseGateway entry vectorTagsHis-tag, Mitochondrial localization signal, and m…Available SinceAug. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQIq_MRGS_HIS8_(27B3)_FLAG
Plasmid#199613PurposeEncodes DARPin-FLAG 27B3 for bacterial expression and column purificationDepositorInsertDARPin-FLAG 27B3
Tags8xHis and FLAGExpressionBacterialPromoterT5Available SinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ E3_5 _hFc
Plasmid#199617PurposeEncodes DARPin-hFc E3_5 for mammalian expression and column purificationDepositorInsertDARPin-hFc E3_5 (control)
TagshFcExpressionMammalianPromoterCMVAvailable SinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only