We narrowed to 6,059 results for: ATC
-
Plasmid#144963PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TFORF1056
Plasmid#141789PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (GAPDH)
Plasmid#180183PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with 8 bp bulge loops (GAPDH)
Plasmid#170121PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with 8bp bulge loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-3'UTR mouse Il13 mutDRACH
Plasmid#207130PurposeLuciferase vector containing 3'UTR for mouse Il13 with mutated DRACH sitesDepositorInsertInterleukin 13 (Il13) 3'UTR (Il13 Mouse)
UseLuciferaseExpressionMammalianMutationTGAGGAGAGACCATCCCTGGGCATCTCAGCTGTGGACTCATTTTCCTTT…Available SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode15
Plasmid#226189PurposeExpression mappingDepositorInsertSyn Barcode15
UseAAVAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode14
Plasmid#226188PurposeExpression mappingDepositorInsertSyn Barcode14
UseAAVAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode8
Plasmid#229070PurposeExpression mappingDepositorInsertCAG Barcode8
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
1197R_gZBF-ER
Plasmid#241825PurposegRNA expressing plasmid with broken SEPARATORDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Pi21
Plasmid#126892PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
1197TCC_gZBF-HG
Plasmid#241826PurposepgSIT 2.0 gRNA expressing plasmid with working HR5Ie1-EGFP SEPARATOR cassetteDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Gria1 Donor;3xV5 KO;Dlg4
Plasmid#240294PurposeKI:Gria1 Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Gria1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCsRNAP
Plasmid#182746PurposeSwapping in small RNA promoter, 23-bp spacer sequence, & 19-bp repeats into pJC005 plasmidsDepositorInsertsmall RNA promoter, a 23-bp spacer sequence, & 19-bp repeats
UseCRISPRAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3387_KanR_4p
Plasmid#247310PurposeProduction of pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3387 in Carbonell et al. 2018DepositorInsertsAtCHI
AtCHS
Sc4CL
AtPAL
ExpressionBacterialPromoterPLacUV5Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB06_3360_6p
Plasmid#247311PurposeProduction of pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3360 in Carbonell et al. 2018DepositorInsertsAtCHI
AtCHS
Sc4CL
AtPAL
ExpressionBacterialPromoterPtrc with lac operator and noneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3360_KanR_2p
Plasmid#247302PurposeProduction of pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3360 in Carbonell et al. 2018DepositorInsertsAtCHI
AtCHS
Sc4CL
AtPAL
ExpressionBacterialPromoterPtrc with lac operonAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3386_KanR_7p
Plasmid#247309PurposeProduction of pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3386 in Carbonell et al. 2018DepositorInsertsAtCHI
Sc4CL
AtCHS
AtPAL
ExpressionBacterialPromoterPlacUV5 with lac operonAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only