We narrowed to 10,650 results for: t7
-
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pr2-T7RNAP
Plasmid#67739PurposeOR2-OR1-P2 promoter expressing T7 RNAPDepositorInsertUTR1-T7RNAP-T500
UseSynthetic BiologyExpressionBacterialPromoterOR2-OR1-Pr2Available SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZB573_pB1H1_T7-RNAP_LARP-I5CHO_1
Plasmid#228508PurposeBacterial Hybrid Driver PlasmidDepositorInsertT7 RNAP, LARP-I5CHO (#1)
UseSynthetic BiologyTagsUmu Degron, GTG-start codonMutationR378K; S430P, N433T, S633P, F849I, F880Y; W727G, …Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZB578_pB1H1_T7-RNAP_LARP-I
Plasmid#228507PurposeBacterial Hybrid Driver PlasmidDepositorInsertT7 RNAP, LARP-I
UseSynthetic BiologyTagsUmu Degron, GTG-start codonMutationR378K; S430P, N433T, S633P, F849I, F880Y; W727G, …Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-5'TwStrep
Plasmid#208620PurposeEmpty vector for prokaryotic expression, insert a Twin Strep tag between NdeI and BamHI site of pET28a (+), both site retained, T7 tag replaced, BamHI site in-frame with Twin Strep tag.DepositorTypeEmpty backboneTagsTwin StrepExpressionBacterialPromoterT7Available SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET E. coli expression vector with BioBrick polypromoter restriction sites (14-A)
Plasmid#48307DepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET LIC cloning vector with BioBrick polycistronic restriction sites (9A)
Plasmid#48283DepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGBR22-pGEM-T
Plasmid#231055PurposeExpresses Montipora efflorescens GFP-like chromoprotein under T7 with a 6xHIS tagDepositorInsertGFP-like chromoprotein
UseCloningTags6x HISPromoterT7Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE-4A6-vioC-3A2-vioD
Plasmid#73440PurposeViolacein pathway (vioABECD) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variants G6 (vioABE), 4A6 (vioC), and 3A2 (vioD) for orthogonal flux redirection.DepositorInsertPG6-vioABE-P4A6-vioC-P3A2-vioD
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6, P4A6, and P3A2 (orthogonal T7-lac variants)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP2283
Plasmid#70702PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2266
Plasmid#70705PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS-Cx43
Plasmid#65439PurposeCloning, T7 RNA expressionDepositorAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET His6 TEV expression vector with BioBrick polypromoter restriction sites (14-B)
Plasmid#48308DepositorTypeEmpty backboneTagsHis6ExpressionBacterialAvailable SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Sumo TEV expression vector with BioBrick polypromoter restriction sites (14-S)
Plasmid#48313DepositorTypeEmpty backboneTagsHis6 and SumoExpressionBacterialAvailable SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 msfGFP TEV cloning vector with BioBrick polycistronic restriction sites (9GFP)
Plasmid#48287DepositorTypeEmpty backboneTagsHis6 and msfGFPExpressionBacterialAvailable SinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 TEV cloning vector with BioBrick polycistronic restriction sites (9B)
Plasmid#48284DepositorTypeEmpty backboneTagsHis6ExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET MBP TEV expression vector with BrioBrick polypromoter restriction sites (14-Q)
Plasmid#48311DepositorTypeEmpty backboneTagsMBPExpressionBacterialAvailable SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Sumo TEV cloning vector with BioBrick polycistronic restriction sites (9S)
Plasmid#48291DepositorTypeEmpty backboneTagsHis6 and SumoExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Thioredoxin TEV cloning vector with BioBrick polycistronic restriction sites (9T)
Plasmid#48292DepositorTypeEmpty backboneTagsHis6 and ThioredoxinExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 MBP TEV expression vector with BioBrick polypromoer restriction sites (14-C)
Plasmid#48309DepositorTypeEmpty backboneTagsHis6 and MBPExpressionBacterialAvailable SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only