We narrowed to 14,379 results for: Cre
-
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pBS L30 Flag-Apex-Rab7A
Plasmid#135652PurposeRab7A fused to APEX2 and a Flag tag in N-ter under control of a weak L30 promoter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRab7A (RAB7A Human)
TagsApex2 and FLagExpressionMammalianPromoterL30Available sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
JP705: pMVP/SB/Neo-DEST
Plasmid#121866PurposepMVP destination vector, empty Sleeping Beauty transposon vector backbone w/ Neo selection cassetteDepositorTypeEmpty backboneUseSleeping beauty transposon, pmvp gateway destinat…ExpressionMammalianAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO101: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-Dnmt3a3L
Plasmid#121833PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the Dnmt3a-3L DNA methyltransferase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertx-dCas9(3.7)/Dnmt3a-3L (open)
UseGateway Cloning and Synthetic BiologyTagsNLSAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
BMR1_01g02031-bio-His
Plasmid#108116Purpose[Edit] Expresses enzymatically monobiotinylated full-length BMR1_01g02031 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tagDepositorInsertBMR1_01g02031
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable sinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ncam1_0.0.0-Fc-His
Plasmid#72086PurposeExpresses the extracellular region of the NCAM1, isoform 0.0.0 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable sinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Jam2-Fc-His
Plasmid#72079PurposeExpresses the extracellular region of the JAM-2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Cx43-YA/VD-GFP
Plasmid#60703Purposemammalian expression of rat Cx43 YA/VD mutant fused to GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCx43 (Gja1 Rat)
TagsEGFPExpressionMammalianMutationYA/VD (Y286A/V289D)PromoterCMVAvailable sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
Prohibitin-bio-His
Plasmid#50800PurposeExpresses enzymatically monobiotinylated full length ProhibitinDepositorInsertProhibitin
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable sinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
P12p-bio
Plasmid#47726PurposeExpresses enzymatically monobiotinylated full-length P12p ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorPublicationInsertCodon-optimised P12p
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_0606800-bio
Plasmid#47790PurposeExpresses enzymatically monobiotinylated full-length PF3D7_0606800 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorPublicationInsertCodon-optimised PF3D7_0606800
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
pHAGE-DD-KNL1-rvsf_aaaa-dCas9
Plasmid#248565PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertDD-KNL1-rvsf_aaaa-dCas9
UseCRISPRTagsHA, 2xNLSExpressionMammalianMutationKNL1 RVSF58-61AAAA; Cas9 D10A, H840APromoterCMV, TetO2Available sinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human beta1 full
Plasmid#221401PurposeMammalian expression of human integrin beta1 full-lengthDepositorInsertintegrin beta1 full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEB multi-Hyg Human collagen type IV alpha 4 chain (COL4A4)
Plasmid#229771Purpose3xFlag-tagged human Col4A4 to be used with N- or C-tagged LgBiT Col4A5 and SmBiT Col4A3 in Nanobit assay systemDepositorInsertHuman collagen type IV alpha 4 chain (COL4A4) (COL4A4 Human)
Tags3xFLAGExpressionMammalianAvailable sinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY101-RetroEFS-HER2-28BBz-PRODH2-WPRE
Plasmid#192202PurposeRetro-HER2CAR-PRODH2DepositorAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDYU1G/mRuby3–histone H1; γ-tubulin-mEGFP
Plasmid#154303PurposeExpresses mRuby3–histone H1 and γ-tubulin-mEGFP from actin15 promoter in Dictyostelium discoideumDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertshistone H1
γ-tubulin
UseDictyostelium expressionTagsmEGFP and mRuby3Promoteractin15Available sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLIB_3xFlag-His6-nsp13 (SARS-CoV-2)
Plasmid#169189PurposeBaculoviral transfer vector to express 3xFlag-His6-nsp13 (SARS-CoV-2) in insect cellsDepositorInsert3xFlag-His6-nsp13 (ORF1ab Synthetic, SARS-CoV-2)
Tags3xFlag-His6ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_UdgX-EE-UdgX-NG-nCas9-UdgX
Plasmid#163572PurposeMammalian CG-to-GC base editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUdgX-EE-UdgX-NG-nCas9-UdgX
UseCRISPRExpressionMammalianMutationnCas9 (D10A)EE (R126E, R132E)NG (L111R, D1135V, G…Available sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only