We narrowed to 10,839 results for: yeast
-
Plasmid#180206PurposeExpression GAL4-fusion of Co-NF-kB in yeastDepositorInsertCo-NF-kB
TagsGAL4 (1-147) fusionExpressionYeastMutationaa 2-1224PromoterAdhIAvailable sinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGB-As-NF-kB2
Plasmid#180210PurposeExpresses GAL4-fusion protein of Acanthoeca spectabilis NF-kB2 protein in yeastDepositorInsertAs-NF-kB2
TagsGAL4 (aa 1-147) fusion proteinExpressionYeastMutationaa 2-502PromoterAdhIAvailable sinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGB-Co-Cterm
Plasmid#180208PurposeExpresses GAL4 fusion of Capsaspora NF-kB C-terminal sequences in yeastDepositorInsertCo-RHD
TagsGAL4 (1-147) fusionExpressionYeastMutationaa 542-1224PromoterAdhIAvailable sinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGB-As-NF-kB3
Plasmid#180211PurposeExpresses GAL4-fusion protein of Acanthoeca spectabilis NF-kB3 protein in yeastDepositorInsertAs-NF-kB3
TagsGAL4 (aa 1-147) fusion proteinExpressionYeastMutationaa 2-412PromoterAdhIAvailable sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSJ982
Plasmid#176622PurposeExpress yeast Ub-MPGLW-Fbp1-3xflag and reference flag-DHFR-ha protein, both are contolled by tetracycline mediated TDH promter, test protein expression and stability.DepositorInsertUb-MPGLW-Fbp1
TagsUbiquitin N-terminal fusion and triple flag tag C…ExpressionYeastMutationChanged first 4 N-terminal amino acid residues of…PromoterTDH3tc3Available sinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
p406 – TDH3-ER-FlucDM-GFP11-Ura
Plasmid#177731PurposeDM Firefly luciferase reporter fused to a KAR2 signal sequence for ER targeting and HDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminus in yeast plasmid withDepositorInsertFlucDM
TagsGFP11, HA, HDEL, and KAR2 Signal SequenceExpressionBacterial and YeastMutationR188Q, R261Q (Destabilized Mutant)Available sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p406 – TDH3-ER-FlucDM-GFP- Ura
Plasmid#177732PurposeDM Firefly luciferase reporter fused to a KAR2 signal sequence for ER targeting and HDEL for ER retention and fused to eGFP at the C-terminus in yeast plasmid with URA markerDepositorInsertFlucDM
TagsHA, HDEL, KAR2 Signal Sequence, and eGFPExpressionBacterial and YeastMutationR188Q, R261Q (Destabilized Mutant)Available sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG416GALL-ccdB-6stop
Plasmid#203511PurposeGateway-compatible destination vector for yeast expression with GALL promoter/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-3x-uC-ccdB-6stop
Plasmid#203514PurposeGateway-compatible destination vector for yeast expression with GAL1 promoter (3x GAL4 binding sites)/upstream ORF/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-ccdB-6stop
Plasmid#203512PurposeGateway-compatible destination vector for yeast expression with GAL10 promoter/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-1x-ccdB-6stop
Plasmid#203519PurposeGateway-compatible destination vector for yeast expression with GAL1 promoter (1x GAL4 binding sites)/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-2x-uA-ccdB-6stop
Plasmid#203517PurposeGateway-compatible destination vector for yeast expression with GAL1 promoter (2x GAL4 binding sites)/upstream ORF/6stop mutation/URA3 markerDepositorTypeEmpty backboneExpressionYeastAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS413-CUP1pr-NFAPoptim
Plasmid#221110PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-CUP1pr-CFAPoptim
Plasmid#221111PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-NFAPoptim
Plasmid#221088PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-CFAPoptim
Plasmid#221089PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-NFAPoptim
Plasmid#221093PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-CFAPoptim
Plasmid#221094PurposeFAP insert for C-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-ADH1pr-NFAPoptim
Plasmid#221096PurposeFAP insert for N-terminally tagging genes of interest (optimized FAP for yeast expression + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only