We narrowed to 24,724 results for: c-myc
-
Plasmid#223375PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT04
Plasmid#223376PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT01
Plasmid#223373PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDM1514-Plin
Plasmid#252025PurposeDictyostelium discoideum, safe haven knock-in plasmid for the act5 locus, N-terminal mCherry taggingDepositorInsertplin
UseAmoebal expressionTagsmCherryAvailable SinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pG20_3C_mCherry_TEV_mVenus_Hyg
Plasmid#240654PurposeExpression plasmid for 3C-mCherry-TEV-mVenus-tagged proteins with Hygromycin transgenic seed selectionDepositorTypeEmpty backboneTags3C-mCherry-TEV-mVenusExpressionPlantAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT06
Plasmid#223378PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEM_Δflv3.sm
Plasmid#185533Purposea pGEM-T easy vector containing the streptomycin/spectinomycin resistance cassette flanked by the two regions for the double homologous recombination on the flv3 locusDepositorInsertaadA gene flanked by flv3 upstream and downstream regions
UseSynthetic BiologyAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAID6
Plasmid#136989PurposeYeast integration plasmid for expression of dLbCpf1-VP, dSpCas9-RD1152, SaCas9, and Csy4DepositorInsertsdLbCpf1-VP
dSpCas9-RD1152
SaCas9
Csy4
ExpressionYeastPromoterENO2, TDH3, TEF1, and TPI1Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTJK512
Plasmid#121469PurposeCEN LEU2 CNB1DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT100-neo
Plasmid#123137PurposeGolden Gate donor vector for the assembly of EGFP-based mammalian recombinase reporters.DepositorInsertNeomycin, poly-A terminator
UseSynthetic Biology; Golden gate donor vectorPromoternoneAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDM1513-Vps32
Plasmid#252024PurposeDictyostelium discoideum, safe haven knock-in plasmid for the act5 locus, N-terminal GFP tagging of the gene Vps32DepositorInsertVps32
UseAmoebal expressionTagsGFPAvailable SinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTJK502
Plasmid#121457PurposeCEN HIS3 CNB1DepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTJK518
Plasmid#121475PurposeCEN TRP1 CNA1ΔAIDDepositorInsertCNA1deltaAID
UseYeast cen vectorMutationTruncated after amino acid 508PromoterEndogenous genomic promoter regionAvailable SinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTJK519
Plasmid#121476PurposeCEN TRP1 CNA1ΔCBDDepositorInsertCNA1deltaCBD
UseYeast cen vectorMutationTruncated after amino acid 453PromoterEndogenous genomic promoter regionAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCAG-G-Flamp2
Plasmid#192782Purposegreen biosensor for cAMP in mammalian cellsDepositorInsertG-Flamp2
TagsHis tagExpressionMammalianPromoterCAGAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TK-Firefly-Control
Plasmid#122277PurposeLentiviral vector for stable expression of Firefly luciferase.DepositorInsertFirefly luciferase
UseLentiviral and LuciferaseExpressionBacterialPromoterThymidine kinaseAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV-3xFLAG-gateway-EGFP
Plasmid#122845PurposeN-terminal 3xFLAG tag and C-terminal EGFP tag. Gateway destination vector for mammalian expression.DepositorTypeEmpty backboneUseGateway CloningTags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-Z3EV
Plasmid#157659PurposeGFP gene and gRNA under Z3EV expression control (estradiol sensor), with Z3EV transcription factor to insert in the genome.DepositorInsertGFP-gRNA NatMX Z3EV
UseInsert storage (replicative in e. coli)Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only