We narrowed to 24,612 results for: crispr
-
Plasmid#103864PurposedPspCas13b-ADAR2DD(E488Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNA. Longer linker than pC0039.DepositorInsertsUseCRISPRTagsGSGGGGS and HIV NESExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…Available SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8
Plasmid#71828PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a controlDepositorInsertBACH2-sgRNA8 (BACH2 Human, Synthetic, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJR89
Plasmid#140096PurposesgRNA constant region and hU6 insert for programmed dual sgRNA cloning. The sgRNA constant region contains a capture sequence (cs1) in the stem loop for direct capture Perturb-seq.DepositorInsertsgRNA constant region CR3 with cs1 in stem loop and hU6 promoter
Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpRY-P2A-EGFP (RTW5025)
Plasmid#140003PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpRY(D10A/A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpRY with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpRY=A61R/L1111R/D1135L/S1136W/G121…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-hSyn-mCherry
Plasmid#87916PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)DepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterhSynAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas-MmdCas12m-CBE1
Plasmid#192284PurposeMmdCas12m-CBE1 expressed under a constitutive promoterDepositorInsertMmdCas12m-CDA-UGI
UseCRISPRExpressionBacterialMutationD485APromoterPJ23108Available SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC0047-CMV-dPspCas13b-ADAR1DD(E1008Q)
Plasmid#103863PurposedPspCas13b-ADAR1DD(E1008Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNADepositorInsertsUseCRISPRExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…Available SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLQ4428 pHR (EF1a-mCherry-P2A-RfxCas13d-2xNLS-ecDHFR-3xFLAG-WPRE)
Plasmid#214885PurposeLentiviral vector encoding TMP-regulatable RfxCas13d-DD fusionDepositorInsertEF1a-mCherry-P2A-RfxCas13d-2xNLS-ecDHFR-3xFLAG-WPRE
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEF1aAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-SpCas9-NG
Plasmid#117919PurposeExpresses 3xFLAG-NLS-SpCas9-NG-NLS in mammalian cells.DepositorInsertSpCas9-NG (L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSJX022
Plasmid#232325PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and catExpressionBacterialPromoterPJ23119 and PvanAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-PEmax
Plasmid#187893PurposeAll-in-one prime editor piggyBac transposon with PEmaxDepositorInsertSpCas9_H840A_KK-MMLV-RT_co-P2A-PAC_dTK
UseCRISPR and Synthetic Biology; Piggybac transposonTagsBPSV40 NLS and c-Myc NLSExpressionMammalianPromoterCAGAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-PEmax SpG
Plasmid#187895PurposeAll-in-one prime editor piggyBac transposon with PEmax, SpG variantDepositorInsertSpCas9_H840A_KK_SpG-MMLV-RT_co-P2A-PAC_dTK
UseCRISPR and Synthetic Biology; Piggybac transposonTagsBPSV40 NLS and c-Myc NLSExpressionMammalianPromoterCAGAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.VSVg_NGFR
Plasmid#158241PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Pten
Plasmid#59909PurposepX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpRY-P2A-EGFP (RTW4830)
Plasmid#139989PurposeCMV and T7 promoter expression plasmid for human codon optimized SpRY(A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpRY with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N131…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
CARPID BASU-dCasRx
Plasmid#153209Purposeexpress CARPID BASU-dCasRx fusion protein in mammalian cellsDepositorInsertBASU-dCasRx
UseCRISPR and LentiviralExpressionMammalianMutationR239A/H244A/R858A/H863A in RfxCas13dPromoterEF-1aAvailable SinceJune 29, 2020AvailabilityAcademic Institutions and Nonprofits only