We narrowed to 973 results for: V2
-
Plasmid#201609PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPABPC1 (PABPC1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGMC00007
Plasmid#166725Purposenon targeting sgRNADepositorInsertNon-targeting guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, Membrane Proteins (m6), top 5 sgRNAs/gene
Pooled Library#83994PurposeMouse CRISPRi Pooled Library targeting membrane proteinsDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Cancer and Apoptosis (h2), top 5 sgRNAs/gene
Pooled Library#83981PurposeHuman CRISPRa Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi-v2, Membrane Proteins (h6), top 5 sgRNAs/gene
Pooled Library#83976PurposeHuman CRISPRi Pooled Library targeting membrane proteinsDepositorAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Membrane Proteins (h6), top 5 sgRNAs/gene
Pooled Library#83985PurposeHuman CRISPRa Pooled Library targeting membrane proteinsDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, Membrane Proteins (m6), top 5 sgRNAs/gene
Pooled Library#84003PurposeMouse CRISPRa Pooled Library targeting membrane proteinsDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi-v2, Gene Expression (h5), top 5 sgRNAs/gene
Pooled Library#83975PurposeHuman CRISPRi Pooled Library targeting gene expressionDepositorAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi-v2, Cancer and Apoptosis (h2), top 5 sgRNAs/gene
Pooled Library#83972PurposeHuman CRISPRi Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Gene Expression (h5), top 5 sgRNAs/gene
Pooled Library#83984PurposeHuman CRISPRa Pooled Library targeting gene expressionDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, Cancer and Apoptosis (m2), top 5 sgRNAs/gene
Pooled Library#83999PurposeMouse CRISPRa Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, Stress and Proteostasis (m3), top 5 sgRNAs/gene
Pooled Library#83991PurposeMouse CRISPRi Pooled Library targeting stress and proteostasis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, Gene Expression (m5), top 5 sgRNAs/gene
Pooled Library#84002PurposeMouse CRISPRa Pooled Library targeting gene expressionDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, Gene Expression (m5), top 5 sgRNAs/gene
Pooled Library#83993PurposeMouse CRISPRi Pooled Library targeting gene expressionDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, Stress and Proteostasis (m3), top 5 sgRNAs/gene
Pooled Library#84000PurposeMouse CRISPRi Pooled Library targeting stress and proteostasis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi-v2, Stress and Proteostasis (h3), top 5 sgRNAs/gene
Pooled Library#83973PurposeHuman CRISPRi Pooled Library targeting stress and proteostasis genesDepositorAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, Cancer and Apoptosis (m2), top 5 sgRNAs/gene
Pooled Library#83990PurposeMouse CRISPRi Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Stress and Proteostasis (h3), top 5 sgRNAs/gene
Pooled Library#83982PurposeHuman CRISPRa Pooled Library targeting stress and proteostasis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only