We narrowed to 2,931 results for: prep
-
Plasmid#253341Purposemitochondrial TOMO70 NTD tagged with Delta6 and GFPDepositorInsertTOMO70-NTD-Delta6-GFP (TOMM70 Human)
UseLentiviralTagsGFPExpressionMammalianPromoterUBCAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CAG(del)-FLEx(loxP)-eYFP(nuclear)-2A-N2cG
Plasmid#248664PurposeHelper virus for monosynaptic tracing; Expresses nuclear eYFP and Rabies Glycoprotein (G) of CVS-N2c strain in Cre-expressing cells under the CAG promoter.DepositorInsertsN2c(G)
nuc-eYFP
UseAAVExpressionMammalianAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CAG(del)-FLEx(loxP)-mCherry(nuclear)-2A-N2cG
Plasmid#248663PurposeHelper virus for monosynaptic tracing; Expresses nuclear mCherry and Rabies Glycoprotein (G) of CVS-N2c strain in Cre-expressing cells under the CAG promoter.DepositorInsertsN2c(G)
nuc-mCherry
UseAAVExpressionMammalianAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a-FLEx(FRT)-stGtACR2:eGFP (soma-targeted)
Plasmid#248662PurposeExpresses a soma-targeted GtACR2 in Flp-expressing cells under the EF1a promoter for neuronal inhibition.DepositorInsertstGtACR2
UseAAVTagsKv2.1 (C terminal on insert) and eGFPExpressionMammalianPromoterEF1aAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆11cag
Plasmid#245370PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆11cag (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation11-bp deletion, H96Wfs*4, plus 3 synonymous mutat…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆7cg
Plasmid#245371PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆7cg (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation7-bp deletion, H96Vfs*29, plus 2 synonymous mutat…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_HA-spGFP11
Plasmid#240224PurposeGateway entry clone for cloning in insert sequences by gibson assembly to create a C-terminal HA-spGFP11 tag. No ATG start codon.DepositorTypeEmpty backboneUseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3D+3N
Plasmid#234614PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 aspartates mutated to asparagineDepositorInserthnRNPA1_LCD_3DN (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214N, D242N, D250NPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -4D+4N
Plasmid#234611PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 4 aspartates mutated to asparagineDepositorInserthnRNPA1_LCD_4DN (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214N, D242N, D250N, D262NPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -4D+4V
Plasmid#234610PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 4 aspartates mutated to valineDepositorInserthnRNPA1_LCD_4DV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214V, D242V, D250V, D262VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3D+3V
Plasmid#234613PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 aspartates mutated to valineDepositorInserthnRNPA1_LCD_3DV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214V, D242V, D250VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRHA
Plasmid#232994PurposeGalactose iduced expression of Gcn4 SATtoG KtoRHAin yeastDepositorInsertGcn4 SATtoG KtoR
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoR
Plasmid#232961PurposeGalactose iduced expression of Gcn4 ATtoG KtoR in yeastDepositorInsertGcn4 SATtoG KtoR
TagsTEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRGFP
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only