We narrowed to 42,628 results for: tro
-
Plasmid#215513PurposeSingle stranded AAV eGFP reporter vector with SCP1 promoter.DepositorInserteGFP
UseAAVExpressionMammalianPromoterSCP1Available SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3831_pGEEC579_pShip-UbC(no_intron)-mRuby2-bGH
Plasmid#239742PurposePlasmid expressing mRuby from a UbC promoter lacking an intron, used for modRNA productionDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3774_pGEEC580_pShip-EF1a(no_intron)-mRuby2-bGH
Plasmid#239743PurposePlasmid expressing mRuby from an EF1a promoter lacking an intron, used for modRNA productionDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-ER WPRE
Plasmid#236230PurposeAAV expression of a fluorescent marker, mEmerald fused to Prolactin signal peptide and KDEL sequence; for expression and retention in the lumen of the endoplasmic reticulumDepositorInsertmEmerald-PRL signal peptide-KDEL sequence (PRL Bovine)
UseAAVTagsmEmeraldPromoterhuman Synapsin 1Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-IRSp53 P278D P281D
Plasmid#221320PurposeDox-inducible expression of IRSp53 mutant in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJPT025-24 Angstrom 12TMD de novo_mRFP1_3x FLAG
Plasmid#202507PurposeExpress 24 Angstrom 12TMD de novo proteinDepositorInsert24 Angstrom 12TMD de novo
TagsmRFP1-3x FLAGExpressionMammalianPromoterCMVAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJPT026-32 Angstrom 4TMD de novo_mRFP1_3x FLAG
Plasmid#202508PurposeExpress 32 Angstrom 4TMD de novo proteinDepositorInsert32 Angstrom 4TMD de novo
TagsmRFP1-3x FLAGExpressionMammalianPromoterCMVAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJPT028-40 Angstrom 12TMD de novo_mRFP1_3x FLAG
Plasmid#202510PurposeExpress 40 Angstrom 12TMD de novo proteinDepositorInsert40 Angstrom 12TMD de novo
TagsmRFP1-3x FLAGExpressionMammalianPromoterCMVAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJPT024-24 Angstrom 4TMD de novo_mRFP1_3x FLAG
Plasmid#202506PurposeExpress 24 Angstrom 4TMD de novo proteinDepositorInsert24 Angstrom 4TMD de novo
TagsmRFP1-3x FLAGExpressionMammalianPromoterCMVAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJPT027-40 Angstrom 4TMD de novo_mRFP1_3x FLAG
Plasmid#202509PurposeExpress 40 Angstrom 4TMD de novo proteinDepositorInsert40 Angstrom 4TMD de novo
TagsmRFP1-3x FLAGExpressionMammalianPromoterCMVAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-tubgenomic-PTC62-deltaIntron3_D
Plasmid#146146PurposeMammalian Expression of tubgenomic-PTC62-delIntron3DepositorInserttubgenomic-PTC62-delIntron3
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-woolly-monkey-retroCHMP3(148)-HA
Plasmid#154250Purposeexpresses prematurely truncated woolly monkey retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsHAExpressionMammalianMutationC-terminal truncation of retroCHMP3 at amino acid…PromoterEF1-alphaAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-pygmy-marmoset-retroCHMP3(148)-HA
Plasmid#154251Purposeexpresses prematurely truncated pygmy marmoset retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsHAExpressionMammalianMutationC-terminal truncation of retroCHMP3 at amino acid…PromoterEF1-alphaAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-PP-squirrel-monkey-retroCHMP3
Plasmid#154184Purposeexpresses squirrel monkey retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsFLAG, Strep-Tag II, and preScission siteExpressionMammalianPromoterCAGAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2365 - Intron GG1 - 250bp no PATC
Plasmid#159883PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG1 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2345 - Intron GG2 - 250bp no PATC
Plasmid#159884PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG2 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2366 - intron GG3 - 250bp no PATC
Plasmid#159885PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertintron GG3 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Dox human Citron shRNA 1 GFP
Plasmid#155291PurposeLentivirus for doxycycline inducible expression of human Citron shRNA, GFP marker, based on Addgene 11652DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 GFP
Plasmid#155286PurposeLentiviral expression of human CIT shRNA, GFP expression, based on Addgene 12247DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only