We narrowed to 12,809 results for: HAL;
-
Plasmid#220302Purposemammalian expression of Bcl-2-A131L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only
-
GFP-Bcl-2-G128L
Plasmid#220301Purposemammalian expression of Bcl-2-G128L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKM 1996
Plasmid#217825PurposeExpresses putative photoreceptor SA-phr1 from S. alba. This gene shows high homology to the phr genes in prokaryotes.DepositorInsertSA-phr1
TagsMaltose-binding proteinExpressionBacterialAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtTAS1c-D2-NbSu-2-AtMIR173a
Plasmid#213401PurposePlant expression vector (2x35S) for expressing a syn-tasiRNA against Nicotiana benthamiana SULFUR gene from AtTAS1c precursorDepositorInsertArabidopsis TAS1c with a syn-tasiRNA sequence at D2 for silencing N. benthamiana SULFUR gene. MIR173 cassette.
ExpressionPlantPromoter2x35SAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLeo-A-a2-GEMS(PLCG)
Plasmid#209114PurposeTransient mammalian expression of the CC functionalized GEMS receptor A-a2-GEMS (PLCG)DepositorInsertA-a2-GEMS(PLCG)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6 N352A HA
Plasmid#208365PurposeExtracellular HA-tagged Fzd6 N352A (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6 S354I HA
Plasmid#208364PurposeExtracellular HA-tagged Fzd6 S354I (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6HA
Plasmid#208363PurposeExtracellular HA-tagged Fzd6 (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2C-ZF
Plasmid#200917PurposeExpress HD2C-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2C (HD2C Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-CPL2-ZF
Plasmid#200918PurposeExpress CPL2-ZF108 in Arabidopsis target FWA geneDepositorInsertCPL2 (CPL2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-JMJ18-ZF
Plasmid#200919PurposeExpress JMJ18-ZF108 in Arabidopsis target FWA geneDepositorInsertJMJ18 (JMJ18 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-ELF7-ZF
Plasmid#200920PurposeExpress ELF7-ZF108 in Arabidopsis target FWA geneDepositorInsertELF7 (ELF7 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-DMS3-ZF
Plasmid#200921PurposeExpress DMS3-ZF108 in Arabidopsis target FWA geneDepositorInsertDMS3 (DMS3 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-SUVH2-ZF
Plasmid#200922PurposeExpress SUVH2-ZF108 in Arabidopsis target FWA geneDepositorInsertSUVH2 (SUVH2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-SUVH9-ZF
Plasmid#200923PurposeExpress SUVH9-ZF108 in Arabidopsis target FWA geneDepositorInsertSUVH9 (SUVH9 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-TRB2-ZF
Plasmid#200926PurposeExpress TRB2-ZF108 in Arabidopsis target FWA geneDepositorInsertTRB2 (TRB2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lnig-INTR-GFP
Plasmid#208904Purposeencodes the inotocin receptor (oxytocin/vasopressin-like) from the ant Lasius niger, tagged with GFPDepositorInsertINTR
TagsEGFPExpressionMammalianAvailable SinceNov. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROF366
Plasmid#155332PurposeExpression of FLuc under the control of AtAP1 promoterDepositorInsertPAtAP1-FLuc-TSV40
UseLuciferase and Synthetic BiologyExpressionPlantAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only