We narrowed to 9,843 results for: CAG
-
Plasmid#90945Purpose3rd generation lentiviral gRNA plasmid targeting human ZWILCHDepositorInsertZWILCH (Guide Designation H11.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
BUB1 A5.1 gRNA
Plasmid#90552Purpose3rd generation lentiviral gRNA plasmid targeting human BUB1DepositorInsertBUB1 (Guide Designation A5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Gfi1-exon4(F1)-GFP
Plasmid#91883PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AURKC gRNA (BRDN0001146500)
Plasmid#78054Purpose3rd generation lentiviral gRNA plasmid targeting human AURKCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK2B gRNA (BRDN0001147766)
Plasmid#77400Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAOK2 gRNA (BRDN0001148565)
Plasmid#77249Purpose3rd generation lentiviral gRNA plasmid targeting human TAOK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3CG gRNA (BRDN0001147429)
Plasmid#76333Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CGDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LMTK2 gRNA (BRDN0001148094)
Plasmid#76175Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NTRK1 gRNA (BRDN0001148112)
Plasmid#75965Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BUB1B gRNA (BRDN0001148077)
Plasmid#75918Purpose3rd generation lentiviral gRNA plasmid targeting human BUB1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDG459-HNRNPD-KO
Plasmid#233287PurposeHNRNPD KnockoutDepositorAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-IARS2-tb
Plasmid#232340PurposeExpresses human IARS2 with synonymous mutations (to prevent recognition by siRNA) in mammalian cellsDepositorInsertIARS2 (IARS2 Human)
ExpressionMammalianMutation5 synonymous mutations in the siRNA (ACUUGCAGUCAU…PromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα
Plasmid#183454PurposesgRNA targeting rat PKA-RIIα subunitsDepositorInsertsgRNA targeting rat PKA-RIIα (Prkar2a Rat)
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CASK gRNA (BRDN0001148068)
Plasmid#77403Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SCYL1 gRNA (BRDN0001146995)
Plasmid#76065Purpose3rd generation lentiviral gRNA plasmid targeting human SCYL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only