We narrowed to 81,743 results for: MYC;
-
Plasmid#117145PurposeExpresses the His tagged Saccharomyces cerevisiae Ornithine Decarboxylase in Escherichia coli BL21DepositorInsertSPE1
TagsHistidineExpressionBacterialPromoterT7Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Kan
Plasmid#232092PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
ss-SNAP-TMD-NS3-Gal4
Plasmid#112279PurposeEncodes the membrane-targeted TMD-NS3-Gal4, which exhibits drug-inducible transcription "turn-off" activity. SNAP-tag is fused to the extracellular region of the encoded protein construct.DepositorInsertSNAP-TMD-NS3-Gal4
TagsAU1 (N term on NS3) and HA (C term on NS3)ExpressionMammalianMutationNS3 mutant T54APromoterCMVAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-AktAR
Plasmid#61624PurposeFRET-based biosensor for monitoring Akt activityDepositorInsertAktAR (AKT1 Budding Yeast, Human, Synthetic)
TagsCerulean and cpVenus[E172]ExpressionMammalianPromoterCMVAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-T1977R
Plasmid#69011Purposeactivating MTOR mutationDepositorInsertMTOR-T1977R (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Threonine 1977 to ArginineAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYL236
Plasmid#173184PurposeCRISPR donor plasmid for making the WT EZH2 control cell line. It contains a puromycin resistance gene and an mCherry geneDepositorAvailable SinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-promoter-mIL-6
Plasmid#109296PurposeIL-6 promoter reporter constructDepositorInsertmurine IL-6 promoter (Il6 Mouse)
ExpressionMammalianMutationCMV promoter in pEGFP-N1 replaced with murine IL-…Promotermurine IL-6 promoterAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR-U6gRNA-PGKpuro2ABFP
Plasmid#136405PurposeDonor vector for gRNA subcloning. Required for gRNA cloning into the RCAS-DV. Also constitutively expresses Puromycin linked to TagBFP.DepositorTypeEmpty backboneUseCRISPRMutationBbsI restriction site at position 437 was removed…PromoterU6, PDKAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSc-His6-Sem1Sc
Plasmid#83235PurposepGREG600-His6-Sem1Sc, Expresses the His6-Sem1 in yeastDepositorAvailable SinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-CKAR
Plasmid#123346PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertCerulean3-Cerulean3-FLARE-CKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-D2512H
Plasmid#69017Purposeactivating MTOR mutationDepositorInsertMTOR-D2512H (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Aspartate 2512 to HistidineAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-GFP-FLARE-AKAR
Plasmid#123332PurposeGreen-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertGFP-GFP-FLARE-AKAR
Tags6xHIS, EGFP, T7 tag (gene 10 leader), and Xpress …ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-MED9
Plasmid#15407DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dGZmxh
Plasmid#44552DepositorInsertsPTETREG promoter
yEGFP::ZeoR
UseSynthetic Biology; Expression regulator/reporterExpressionYeastPromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_zeo
Plasmid#184913PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_zeo recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_nat
Plasmid#184914PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_nat recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-Venus-FLARE-AKAR
Plasmid#123331PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertVenus-Venus-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, and Xpress…ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-EKAR-EV
Plasmid#123342PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertCerulean3-Cerulean3-FLARE-EKAR-EV
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only