We narrowed to 12,080 results for: shRNA
-
Plasmid#239915PurposesgRNA-C compatible with TCTP-SynPro-01, TCTP-SynPro-17 and CaMV 35S-SynPro-11 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA-C
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP995
Plasmid#239917PurposesgRNA-E compatible with TCTP-SynPro-04, TCTP-SynPro-06 and CaMV 35S-SynPro-03 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA-E
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP996
Plasmid#239918PurposesgRNA compatible with TCTP-SynPro-05 and CaMV 35S-SynPro-15 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP997
Plasmid#239919PurposesgRNA compatible with TCTP-SynPro-05 and CaMV 35S-SynPro-07 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP999
Plasmid#239921PurposesgRNA compatible with TCTP-SynPro-08 and CaMV 35S-SynPro-04 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP998
Plasmid#239920PurposesgRNA compatible with TCTP-SynPro-06, TCTP-SynPro-13 and CaMV 35S-SynPro-10 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1000
Plasmid#239922PurposesgRNA compatible with TCTP-SynPro-08 and CaMV 35S-SynPro-04 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1007
Plasmid#239929PurposesgRNA compatible with TCTP-SynPro-04, TCTP-SynPro-11 and CaMV 35S-SynPro-08 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1008
Plasmid#239930PurposesgRNA compatible with TCTP-SynPro-10 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1009
Plasmid#239931PurposesgRNA compatible with TCTP-SynPro-10 as Level-0 part (Golden Gate cloning)DepositorInsertsgRNA
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgSOX2
Plasmid#242175PurposeA piggybac-based vector containing mouse U6 promoter-driven SOX2 sgRNA and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgPOU5F1
Plasmid#242174PurposeA piggybac-based vector containing mouse U6 promoter-driven POU5F1sgRNA and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDS48
Plasmid#241839PurposeCas9-gRNA construct targeting the UBE3A locusDepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-ITGB1(no stop)
Plasmid#215453PurposeGateway entry vector with integrin beta1 wild-type (WT) without a stop codonDepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorMutationSilent mutations added to disrupt shRNA binding a…PromoternoneAvailable SinceSept. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ARHGEF7/B-Pix
Plasmid#241368PurposeMammalian expression of SpCas9 and gRNA targeting ARHGEF7 (β-Pix)DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only