We narrowed to 26,769 results for: CAN
-
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP792_L2_FRT-OCS-tGFP_Red_mCherry_HSP-FlpO
Plasmid#192382PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when heat shocked.DepositorInsertAct2::B3RT-OCS-B3RT::Act2::FRT-OCS-FRT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP734_L2pV1_1I_OCS-rLUC_F-NOS-FlpO
Plasmid#192377PurposeTo test if the NOS promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP735_L2pV1_1I_OCS-rLUC_F-TCTP-FlpO
Plasmid#192378PurposeTo test if the TCTP promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
H2B-mNeonGreen_FRB(DmrC)_IRESpuro2
Plasmid#182918PurposeExpesses H2B-mNeonGreen_FRB(DmrC). Can be used to target FKBP(DmrA) tagged proteins to H2BDepositorInsertpH2B (H2BC16P Human)
TagsmNeonGreen-FRB(DmrC)ExpressionBacterial and MammalianPromoterCMVAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_NFL linker-3xFLAG KI
Plasmid#182679PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker-3xFLAG. Can be used for C-terminal tagging of endogenous NFL with a linker-3xFLAG tag.DepositorInsertNefl-targeting gRNA and linker-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-RanGAP*
Plasmid#175238PurposeBacterial expression and purification, low affinity SUMOylation substrate that can recruited to FRB with rapamycin, point mutation F562A reduces affinity for E2, increasing the KmDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj13
Plasmid#173143PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj13 (kcnj13 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj1b
Plasmid#173126PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj1b (kcnj1b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj8
Plasmid#173134PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertUsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only