We narrowed to 22,832 results for: Ide
-
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PTPN22_Y-phosphatase
Plasmid#110048PurposeProtein expression and purification of PTPN22_Y-phosphataseDepositorInsertPTPN22_Y-phosphatase (PTPN22 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
p3E-ING2
Plasmid#109554PurposeMultisite gateway vector for 3' tagging with 3xPHD domain from Mouse inhibitor of growth family member 2 (ING2), codon optimised. Binds PtdIns5PDepositorInsert3xPHD domain from Mouse inhibitor of growth family member 2 (ING2), codon optimised
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-tdTomato-f
Plasmid#127092PurposeAn AAV genome with tet-inducible, Cre-dependent expression of farnesylated (f) tdTomatoDepositorInserttdTomato-f
UseAAVTagsfarnesylation signal from c-Ha-RasExpressionMammalianAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-VIM-BC2T
Plasmid#108966Purposeexpresses mCherry-vimentin-BC2-tag in mammalian cellsDepositorAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPN11i2
Plasmid#59613PurposeExpression of shRNA against human PTPN11DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
ERAS
Plasmid#55656Purposeexpression of mouse ERASDepositorAvailable SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
p6869 pOZ-N puro HA-HPV18 E2
Plasmid#35134DepositorAvailable SinceMarch 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1113
Plasmid#29042PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1265
Plasmid#29137PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1524
Plasmid#29255PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle53 (DCX Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 3, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
piRES-puro-HE4
Plasmid#25727DepositorAvailable SinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14107 fwYellow-targeting sgRNA
Plasmid#239456Purposeguide for fwYellowDepositorInsertguide targeting fwYellow
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14112 tyrosinase-targeting sgRNA
Plasmid#239751Purposeguide for tyrosinaseDepositorInsertguide targeting tyrosinase
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV272
Plasmid#226183PurposeExpresses Cas9 and gRNA targeting uidA gene of the pDIV643 derived cassette.DepositorInserttRNA-sgRNA-tRNA
UseCRISPRExpressionBacterial and YeastPromoterTEF1p (Komagataella phaffii)Available SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
DDX21
Plasmid#155510PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only