We narrowed to 7,091 results for: mCherry
-
Plasmid#245029PurposeConstitutively active human Rab2a Q41L mutantDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLENTICRISPR V2-mCherry sgmRELA_1
Plasmid#241447PurposeDelete mouse RelaDepositorAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEM-PAmCherry-RPA194
Plasmid#247354PurposeCRISPR/Cas9 donor plasmid to tag human RPA194 with PAmCherryDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-Mex3a-mCherry
Plasmid#241312PurposeExpression of Mex3a-mCherry fusion protein in mammalian cellsDepositorAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Rubicon-CGHL
Plasmid#221658PurposeRubicon mutated at four residues in the RH domain to disrupt Rab7 binding, tagged at the N-terminus with mCherryDepositorInsertRUBCN (RUBCN Human)
TagsmCherryExpressionMammalianMutationC912G, C915G, H920L, C923GPromoterCMVAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmRNA-mCherry-A120
Plasmid#225904PurposeIn vitro transcription of cap-dependently translated mRNA encoding mCherry.DepositorInsertsA-inserted T7 class III Φ6.5 promoter
mCherry
2x β-globin UTR
poly(A) tail
UseSynthetic Biology; Mrna preparationExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBSII-NLS-mCherry(AM)
Plasmid#244814PurposeIn-Vitro Synthesis of mRNA encoding a Honeybee-optimized mCherry-labeled Nuclear Localization Signal (NLS) TagDepositorInsertmCherry
UseIn-vitro mrna synthesisTagsSV40 NLSMutationcoding sequence is optimized for the HoneybeePromoterT7Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBSII-MEME-mCherry(AM)
Plasmid#244816PurposeIn-Vitro Synthesis of mRNA encoding a Honeybee-optimized mCherry-labeled GAP43 Membrane Anchor (MEME) TagDepositorInsertmCherry
UseIn-vitro mrna synthesisTagsGAP43 Membrane Anchor (MEME) TagMutationcoding sequence is optimized for the HoneybeePromoterT7Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-mCherry-CAAX
Plasmid#223674PurposeAAV expression of mCherry from hSyn1 promoterDepositorInsertmCherry-CAAX
UseAAVPromoterhSyn1Available SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TVMV Protease-mCherry
Plasmid#243794PurposeEncodes for mammalian expression of TVMV protease input. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTVMV protease
ExpressionMammalianAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-mCherry GAC
Plasmid#227830PurposeTo amplify the virus that expresses C-mCherry GACDepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
AGG1983 UbL40-mCherry
Plasmid#242440PurposeAe aegypti UbL40 promoter expressing mCherryDepositorInsertmCherry
ExpressionInsectAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48A)-mCherry
Plasmid#193635PurposeExpresses S48A phosphodead VAMP3 fused to mCherryDepositorInsertVAMP3 (Vamp3 Mouse)
TagsmCherryExpressionMammalianMutationchanged serine 48 to alaninePromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48E)-mCherry
Plasmid#193637PurposeExpresses S48E phosphomimetic VAMP3 fused to mCherryDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-RILPL1 (R293A)
Plasmid#244981PurposeExpress RILPL1 in mammalian cells with mCherry tag expressing a R293A mutationDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKDcas9 delta mcherry
Plasmid#230940Purposenon-targeting Reference Control; expresses mCherryDepositorInsertdCas9
UseCRISPRMutationadditional tetOAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_TRE3VG_mCherry-Responder
Plasmid#230052PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of mCherry through the OPTi-OX platformDepositorInsertmCherry
ExpressionMammalianAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_UCOE_TRE3VG_mCherry-Responder
Plasmid#230053PurposeIt presents the UCOE sequence and the TRE3VG inducible promoter allowing a more stable dox-dependent inducible activation of mCherry though the OPTi-OX platform across differentiation of hiPSCsDepositorInsertUCOE
ExpressionMammalianPromoterTRE3VGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet_6xHis-TEV-mCherry
Plasmid#227710PurposeExpression of recombinant protein for purification (used as control)DepositorInsertmCherry
ExpressionBacterialAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-P2A-NTRv2-pA
Plasmid#241195PurposeMiddle entry vector for mini-Golden subcloning platform; mCherry; NTR-v2DepositorInsertmCherry; NTR-v2
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
FRT-acrymCherry-FRT
Plasmid#241179PurposeMiddle entry vector for mini-Golden subcloning platform; acry-mCherryDepositorInsertacry-mCherry
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mCherry-Parkin
Plasmid#237397PurposeLentivirus plasmid for the stable expression of mCherry-Parkin in mammalian cellsDepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBneo-UbC-mCherry
Plasmid#228759PurposeEncoding mCherry.DepositorInsertmCherry
ExpressionMammalianPromoterUbC promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMC-ME_memb-mCherry-pA
Plasmid#200528Purposemini circle middle entry plasmid for membrane mCherry-pA with flanking BsaI cut sitesDepositorInsertmCherry
UseMini-goldenAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-mCherry
Plasmid#216174PurposeGenerate lentiviruses to act as a positive transduction control for pHAGE2-TetO vectors in pluripotency reprogrammingDepositorInsertmCherry
UseLentiviralAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW COX8ASig-mCherry
Plasmid#239558PurposeExpression and mitochondrial localization of mCherryDepositorArticleInsertmCherry
UseLentiviralPromoterUbCAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR TRE_TGFbeta3_IRES_mCherry-PGK_BFP
Plasmid#223548PurposeInducible TGF beta 3 and mCherry; constitutive BFPDepositorAvailable SinceJune 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR TRE_SEAP_IRES_mCherry-PGK_BFP-hf
Plasmid#223535PurposeInducible secreted embryonic alkaline phosphatase and mCherry; constitutive BFPDepositorInsertsSecreted alkaline phosphatase
mCherry
TagBFP
UseLentiviralAvailable SinceJune 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
synapsin-hIRβ-mCherry
Plasmid#228449PurposeExpressing a truncated, constitutively active human insulin receptor (IRβ) with mCherry in rat primary hippocampal neuronsDepositorInserthuman Insulin Receptor beta subunit (INSR Human)
UseAAVPromoterneuron-specific synapsin promoteAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-2
Plasmid#237635PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-1
Plasmid#237634PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-FUS-gRNA
Plasmid#237685PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to FUS locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-Nat
Plasmid#236488PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on Nat.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-G418
Plasmid#236490PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on G418.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-mCherry-Hyg
Plasmid#236489PurposePlasmid for deleting or C-terminally tagging endogenous genes with mCherry and selection on Hyg.DepositorInsertmCherry
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1061 (pLenti6.2_CMV_GATA1_P2A_H2A_mCherry)
Plasmid#233543PurposeA CMV driven human GATA1 followed by a P2A cleavage peptide and an H2A mCherry fusion protein.DepositorAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
PHB2 S39A-mCherry
Plasmid#232786PurposeEncodes an mCherry-tagged Prohibitin2/PHB2 non-phosphorylatable on Ser39DepositorInsertPHB2 (PHB2 Human)
TagsmCherryExpressionMammalianMutationChanged Ser 39 to AlaPromoterCMVAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ubi:mTb-ccdb + mcherry
Plasmid#233304PurposeGATEWAY compatible vector with a soybean Ubiquitin (GmUbi) promoter driving in frame epitope fusion of miniTurbo-ID paired with ccdb selection toxin and mCherry markerDepositorInsertUbi:mTb-ccdb + mcherry
UseGateway destinationTagsminiTurbo-IDAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1038 (pLenti6.2_CMV_MYC_TCF4_DN_P2A_H2A_mCherry)
Plasmid#233542PurposeA CMV promoter driving expression of a murine dominant negative myc tagged TCF4.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1063 (pLenti6.2_CMV_V5_MAFB_P2A_H2A_mCherry)
Plasmid#233545PurposeA CMV driven human MAFB followed by a P2A cleavage peptide and an H2A mCherry fusion protein.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1051 (pME_V5_GATA2_P2A_H2A_mCherry)
Plasmid#232128PurposeA middle entry gateway clone containing V5 tagged human GATA2 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1034 (pME_V5_TCF7_P2A_H2A_mCherry)
Plasmid#232124PurposeA middle entry gateway clone containing V5 tagged human TCF7 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1031 (pME_V5_LEF1_P2A_H2A_mCherry)
Plasmid#232123PurposeA middle entry gateway clone containing V5 tagged human LEF1 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1035 (pME_V5_TCF7L1_P2A_H2A_mCherry)
Plasmid#232125PurposeA middle entry gateway clone containing V5 tagged human TCFL7 / TCF3 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1052 (pME_V5_MAFB_P2A_H2A_mCherry)
Plasmid#232129PurposeA middle entry gateway clone containing V5 tagged human MAFB and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1060 (pME_V5_FOXF2_P2A_H2A_mCherry)
Plasmid#232131PurposeA middle entry gateway clone containing V5 tagged human FOXF2 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1059 (pME_V5_GATA4_P2A_H2A_mCherry)
Plasmid#232130PurposeA middle entry gateway clone containing V5 tagged human GATA4 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1036 (pME_V5_TCF7L2_P2A_H2A_mCherry)
Plasmid#232126PurposeA middle entry gateway clone containing V5 tagged human TCF7L2 / TCF4 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only