We narrowed to 44,275 results for: gats
-
Plasmid#82834PurposeGateway Donor vector containing RBM10 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
MAP3K1 gRNA (BRDN0001147696)
Plasmid#77825Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-zFucci-pA-exorh-GFP (JDW 1489)
Plasmid#242593PurposeA Tol2 expression vector containing the zebrafish Ubi promoter driving zFUCCI to label cell cycle state. Exorh-EGFP in the backbone to label pineal cells.DepositorInsertmCerulean-zGeminin, mCherry-zCdt1
UseZebrafish expressioPromoterzebrafish UbiAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Crestin-zFUCCI-IRES-EGFP-caax (JDW 1516)
Plasmid#242601PurposeA Tol2 expression vector containing the Crestin enhancer driving FUCCI to label cell cycle in neural crest cells followed by an IRES-EGFP-caax to label all neural crest cells green.DepositorInsertmCerulean-zGEM-P2A-mCherry-zCdt1
UseZebrafish expressionPromoterCrestin enhancerAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_ NLS~K682A_K686A_K694_K709A (4KA) POLH
Plasmid#246406PurposeExpresses K682A_K686A_K694_K709A POLH with an N-terminal NLS~FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K682A_K686A_K694_K709A. Coding sequence has …Available SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_ NLS~K682R_K686R_K69R_K709R (4KR) POLH
Plasmid#246407PurposeExpresses K682R_K686R_K69R_K709R POLH with an N-terminal NLS~FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K682R_K686R_K69R_K709R. Coding sequence has …Available SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT POLH_ΔGG NEDD8
Plasmid#221860PurposeExpresses FLAG-tagged WT POLH fused to ΔGG NEDD8 in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAG and ΔGG NEDD8ExpressionMammalianMutationCoding sequence has been optimised for expression…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT POLH_ΔGG Ubiquitin
Plasmid#221861PurposeExpresses FLAG-tagged WT POLH fused to ΔGG ubiquitin in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAG and ΔGG UbiquitinExpressionMammalianMutationCoding sequence has been optimised for expression…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_K682A_K709A POLH
Plasmid#221864PurposeExpresses POLH mutated at K682A and K709A with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K682A + K709A. Coding sequence has been opti…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_K682A_K686A_K694A_K709A POLH
Plasmid#221865PurposeExpresses POLH mutated at K682A, K686A, K694A and K709A with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K682A, K686A, K694A + K709A. Coding sequence…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
Neo-2/15-TGFa-SPMn-SpyTag003
Plasmid#246650PurposeExpresses Neo-2/15-TGFa-SPMn-SpyTag003 in mammalian cells for calcium-induced NeissLock protein ligation to epidermal growth factor receptor (EGFR)DepositorInsertNeo-2/15-TGFa-SPMn-SpyTag003
TagsSignal peptide and SpyTag003ExpressionMammalianMutationConstruct contains the tPA signal peptide, Neo2/…PromoterCMV promoterAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)
Plasmid#215451PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF)DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
TFORF3379
Plasmid#144855PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-Off_FLEX_Luc-P2A-H2A-mCherry (JDW 970)
Plasmid#229824PurposeA PiggyBac vector with a cre-dependent dual luciferase / nuclear mCherry reporter. In the presence of cre, this tet-off vector will be ubiquitously expressed in the absence of dox/tetDepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-8D2Q.Tau2N4R-WPRE
Plasmid#226382PurposeExpresses tau propagation ORF with V5 tag on 8D2Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
TagsTagRFP.T.2A.V5ExpressionMammalianMutation8D2Q.Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-20D3Q.Tau2N4R-WPRE
Plasmid#226383PurposeExpresses tau propagation ORF with V5 tag on 20D3Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
TagsTagRFP.T.2A.V5ExpressionMammalianMutation20D3Q, Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-8A2R.Tau2N4R-WPRE
Plasmid#226384PurposeExpresses tau propagation ORF with V5 tag on 8A2R mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
TagsTagRFP.T.2A.V5ExpressionMammalianMutation8A2R, Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-20A3R.Tau2N4R-WPRE
Plasmid#226385PurposeExpresses tau propagation ORF with V5 tag on 20A3R mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
TagsTagRFP.T.2A.V5ExpressionMammalianMutation20A3R, Tau2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-V5-K281Q.Tau2N4R-WPRE
Plasmid#226386PurposeExpresses tau propagation ORF with V5 tag on K281Q mutant 2N4R tauDepositorInsertTau2N4R (MAPT synthetic, Human)
TagsTagRFP.T.2A.V5ExpressionMammalianMutationK281Q, 2N4RAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only