We narrowed to 75,818 results for: gats
-
Plasmid#70773PurposeGateway entry cloneDepositorInsertTfb5 (Tfb5 Fly)
UseGateway entry vectorAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2H02
Plasmid#70877PurposeGateway entry cloneDepositorInserttoy (toy Fly)
UseGateway entry vectorAvailable SinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2G12
Plasmid#70942PurposeGateway entry cloneDepositorInsertSu(z)12 (Su(z)12 Fly)
UseGateway entry vectorAvailable SinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2C09
Plasmid#70919PurposeGateway entry cloneDepositorInsertCaf1-105 (Caf1-105 Fly)
UseGateway entry vectorAvailable SinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2A04
Plasmid#70896PurposeGateway entry cloneDepositorInsertTfb1 (Tfb1 Fly)
UseGateway entry vectorAvailable SinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2H04
Plasmid#70889PurposeGateway entry cloneDepositorInsertcsul (csul Fly)
UseGateway entry vectorAvailable SinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2E10
Plasmid#70929PurposeGateway entry cloneDepositorInsertElp2 (Elp2 Fly)
UseGateway entry vectorAvailable SinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2G03
Plasmid#70882PurposeGateway entry cloneDepositorInsertTfIIFalpha (TfIIFalpha Fly)
UseGateway entry vectorAvailable SinceNov. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2D05
Plasmid#70892PurposeGateway entry cloneDepositorInsertdbo (dbo Fly)
UseGateway entry vectorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2G06
Plasmid#70900PurposeGateway entry cloneDepositorInsertMED17 (MED17 Fly)
UseGateway entry vectorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2H07
Plasmid#70908PurposeGateway entry cloneDepositorInsertCG7179 (CG7179 Fly)
UseGateway entry vectorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2H09
Plasmid#70924PurposeGateway entry cloneDepositorInsertMnn1 (Mnn1 Fly)
UseGateway entry vectorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
p077 pCS xTRPS1 (M)
Plasmid#11047DepositorInsertTRPS1 mut (trps1 Frog)
UseMammalian, avian, and zebrafishMutationTwo Cys residues in the GATA-type zinc finger wer…Available SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pGGG-AH-VRT-A2
Plasmid#163703PurposeWheat transformation vector pGoldenGreenGate (pGGG) with OsActinP:: hygromycin (hpt) selection and the full native Triticum polonicum VRT-A2 gene (native prom::genomic seq::3'UTR)DepositorInsertsOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
Triticum polonicum VRT-A2 genomic sequence (Native promoter:: genomic sequence::3'UTR) + Nos Terminator
ExpressionPlantPromoterRice - Os Actin promoter and Triticum polonicum V…Available SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human, Nematode)
TagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-TDP-43 M337V
Plasmid#162609PurposeAllows for transcription of mutant TDP-43-M337V mRNA for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC35A2_STOP
Plasmid#161313PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC35A2 (SLC35A2 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCS2plus-mCerulean 156-239-GGGS-TDP-43 M337V
Plasmid#162618PurposeAllows for transcription of mCerulean fluorophore half fused to mutant TDP-43-M337V for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS-TDP-43
Plasmid#162617PurposeAllows for transcription of mCerulean fluorophore half fused to TDP-43 for injection into zebrafish embryos for BiFC assaysDepositorInsertTARDBP (TARDBP Human)
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only