We narrowed to 9,883 results for: ren
-
Plasmid#133118PurposePlasmid contains a reporter gene for Crz1. The 1000bp promoter of the gene pYPS1 driving a Venus.DepositorInsertpYPS1-YFP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMK2-Venus
Plasmid#133119PurposePlasmid contains a reporter gene for Crz1. The 1000bp promoter of the gene pCMK2 driving a Venus.DepositorInsertpCMK2-YFP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGYP7-Venus
Plasmid#133120PurposePlasmid contains a reporter gene for Crz1. The 1000bp promoter of the gene pGYP7 driving a Venus.DepositorInsertpGYP7-YFP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJ211_WT_med
Plasmid#128849PurposeMedium copy number plasmid for expression of E. coli flagellin from its natural promoterDepositorInsertFlagellin
ExpressionBacterialAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJ211_rha_WT_hi
Plasmid#128853PurposeHigh copy number plasmid for expression of E. coli flagellin from a rhamnose-inducible promoterDepositorInsertFlagellin
ExpressionBacterialAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUP95Q15AL460PGW (E3)
Plasmid#74033Purposelentiviral expression of Psd95-Q15A L460P-EGFP fusionDepositorInsertPsd95
UseLentiviralExpressionMammalianMutationQ15A, L460PPromoterhUbCAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pISH-Olfr54
Plasmid#105488Purposeto generate a riboprobe for in situ hybridazationDepositorAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB233
Plasmid#68624PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsCitrineExpressionPlantPromoterMpHSP17.8A1 promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB210
Plasmid#68601PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTags3xFLAGExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIhh4.5k-Luc
Plasmid#53603PurposeReporter construct containing a 4.5 kb promoter region of the Ihh gene in front of a luciferase gene for in vitro DNA transfection assaysDepositorInsertIhh promoter
UseLuciferase; ReporterAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
RCAS(B) En cRaxL deltaC (CC#523)
Plasmid#15196DepositorInsertRaxL
UseRetroviral; Avian expressionAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
ALFA-Fibcon (pZYW250)
Plasmid#236354PurposeEncodes ALFA epitope tag fused to a single fibcon domain as a part 3A to be used in the MTKDepositorInsertALFA-Fibcon
UseSynthetic BiologyPromoterNoneAvailable SinceJune 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
VP64-NS3 (pAN3950)
Plasmid#236359PurposeEncodes NS3 gene expression system as a Type 3A part to be used in the MTK systemDepositorInsertVP64-NS3
UseSynthetic BiologyPromoterNoneAvailable SinceJune 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
GAL4 DBD (pAN029)
Plasmid#236360PurposeEncodes GAL4 DNA binding domain to be used as a Type 3B in the MTK systemDepositorInsertGAL4 DBD
UseSynthetic BiologyPromoterNoneAvailable SinceJune 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
Toggle Switch - LuxI
Plasmid#251147PurposeToggle Switch (TetR - mCerulean / LacI - GFP - LuxI)DepositorArticleInsertsLacI
sfGFP-LuxI
TetR
mCerulean
ExpressionBacterialPromoterPLtetO-1 and trc, lacOAvailable SinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
knockin GAPDH-GvpNtoV
Plasmid#232726PurposeGvpN to GvpV genes knockin at the GAPDH locusDepositorInsertGvpN to GvpV
ExpressionMammalianAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGGG-TaBSS1-TaSEP1B6(int)
Plasmid#242012PurposeL2 Golden Gate construct for in planta (wheat) expression of cisgenic SEP1-B6 driven by the Basal Spikelet Specific 1 regulatory environment.DepositorInsertTaSEP1-B6_with_introns
ExpressionPlantPromoterBSS1Available SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGGG-TaBSS1-TaMOFB1(int)
Plasmid#242011PurposeL2 Golden Gate construct for in planta (wheat) expression of cisgenic MOF-B1 driven by the Basal Spikelet Specific 1 regulatory environment.DepositorInsertTaMOF-B1_with_introns
ExpressionPlantPromoterBSS1Available SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only