We narrowed to 2,548 results for: EFS
-
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only
-
TRBV12-4
Plasmid#123446Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRAV2
Plasmid#123369Purposeconstruction of TCRDepositorAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRBV16
Plasmid#123451Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+FLAG-KrascomQ61R
Plasmid#206845PurposeTo express mouse Kras encoded by common mouse codons (to increase expression) and with a Q61R mutation with an N-terminal FLAG tag.DepositorInsertKras (Kras Mouse)
TagsFLAGExpressionMammalianMutationCodons altered to most optimum based on mouse cod…Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 PHD-HAT
Plasmid#179545Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP PHD-HAT
Plasmid#179548Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRBV13
Plasmid#123448Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRBV12-5
Plasmid#123447Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRBV11-3
Plasmid#123444Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRBV11-2
Plasmid#123443Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRBV11-1
Plasmid#123442Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRBV10-1
Plasmid#123439Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRBV9
Plasmid#123438Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRBV7-7
Plasmid#123435Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRBV7-4
Plasmid#123433Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRBV7-3
Plasmid#123432Purposeconstruction of TCRDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only