We narrowed to 4,065 results for: SPL
-
Plasmid#138245PurposeExpresses the split mCherry reporter interrupted by the NrdA-2 intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only
-
P16ΔS:S10-(MCS)-3xHA
Plasmid#108183PurposeBinary vectors used for the constitutive expression of tripartite split-sfGFP components (with a 3xHA tag) in plantsDepositorTypeEmpty backboneUseSynthetic BiologyExpressionPlantPromoterP16ΔSAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSG5-mERRbeta-short
Plasmid#52188PurposeExpresses mouse ERRbeta short form splice variant in mammalian cellsDepositorAvailable SinceApril 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFP.R271
Plasmid#138220PurposeExpresses the split mCherry reporter interrupted by the SspDnaX artificially mini-intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
P16ΔS:(MCS)-3xHA-S11
Plasmid#108185PurposeBinary vectors used for the constitutive expression of tripartite split-sfGFP components (with a 3xHA tag) in plantsDepositorTypeEmpty backboneUseSynthetic BiologyExpressionPlantPromoterP16ΔSAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
plIVMD164
Plasmid#160936PurposeIn vivo mRNA display construct for GFPDepositorInsertMCP-sfGFP-HIS tag, 3'UTR MS2 Stem Loop
TagsHIS tag, 3'UTR MS2 Stem LoopExpressionYeastPromoterMET25Available SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFP.R365
Plasmid#138235PurposeExpresses the split mCherry reporter interrupted by the EP-Pri artificially mini-intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXYB162
Plasmid#239633PurposeRibozyme split sfGFP linked with GFPuv via T2A expressionDepositorInsertsfGFPn_Y66-Ribozyme-2nd_sfGFPc-T2A-GFPuv
UseSynthetic BiologyExpressionPlantAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB163
Plasmid#239634PurposeDeactivated ribozyme split sfGFP linked with GFPuv via T2A expressionDepositorInsertsfGFPn_Y66-dRibozyme-2nd_sfGFPc-T2A-GFPuv
UseSynthetic BiologyExpressionPlantAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCI-SMN2-inclusion-GLuc
Plasmid#218671PurposeAlternative splicing signaling: signal increased with Ex7 inclusion increasingDepositorInsertSMN2 (SMN2 )
ExpressionMammalianAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiT-GEM(0)
Plasmid#220446PurposeSplit intein version of Trojan-Gal4 Expression Module in Phase 0. Insert T2A-Gal4 to genomic loci using Crispr/Cas technology. Can be converted by cassette exchange into other Trojan exonsDepositorInsertCfaN-Gal4-CfaC
ExpressionInsectAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiT-GEM(2)
Plasmid#220448PurposeSplit intein version of Trojan-Gal4 Expression Module in Phase 2. Insert T2A-Gal4 to genomic loci using Crispr/Cas technology. Can be converted by cassette exchange into other Trojan exonsDepositorInsertCfaN-Gal4-CfaC
ExpressionInsectAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiT-GEM(1)
Plasmid#220447PurposeSplit intein version of Trojan-Gal4 Expression Module in Phase 1. Insert T2A-Gal4 to genomic loci using Crispr/Cas technology. Can be converted by cassette exchange into other Trojan exonsDepositorInsertCfaN-Gal4-CfaC
ExpressionInsectAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-MYC-DYK-C302S
Plasmid#115254PurposeFor mammalian expression of a human NODAL splice variant open reading frame (with a mutated Cysteine residue) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-MYC-DYK-C302A
Plasmid#115255PurposeFor mammalian expression of a human NODAL splice variant open reading frame (with a mutated Cysteine residue) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
plIVMD163
Plasmid#160935PurposeIn vivo mRNA display construct for mCherryDepositorInsertMCP-mCherry-HIS tag, 3'UTR MS2 Stem Loop
TagsHIS tag, 3'UTR MS2 Stem LoopExpressionYeastPromoterMET25Available SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP.R373
Plasmid#138243PurposeExpresses the split mCherry reporter interrupted by the SaP-dpol intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP.R362
Plasmid#138232PurposeExpresses the split mCherry reporter interrupted by the CbP-RNR artificially mini-intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only