We narrowed to 1,480 results for: cag promoter
-
Plasmid#231681PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with two tandem mEmeralds in mammalian cells. Assembles into nanocages tagged with 120 mEmerald FPs.DepositorInsertI3-01
UseTagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_I3
Plasmid#231680PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with one mEmerald in mammalian cells. Assembles into nanocages tagged with 60 mEmerald FPs.DepositorInsertI3-01
UseTagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGG184
Plasmid#165604PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with a single hEGFP protospacer: PS1(upstream of promoter with 'CAGCG' PAM)-lac-HIS3 and GFPDepositorInserthEGFP protospacer ('CAGCG' PAM) upstream of the HIS3/GFP promoter
UseSynthetic BiologyTagsExpressionBacterialMutation'CAGCG' PAM replacing the 'CGGCG…PromoterlacAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pstb-LAFR5
Plasmid#86169PurposepLAFR5 with Smb21651 promoter. pLAFR5 is a broad-host range cosmid vector with double cos sites.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterSMb21651 promoterAvailable sinceFeb. 6, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCLYBL-Neo_TRE3VG_mCherry_Responder
Plasmid#230054PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of mCherry through the OPTi-OX platform. The CLYBL GSH supports higher transgene expressionDepositorInsertTRE3VG_mCherry
UseTagsExpressionMammalianMutationPromoterTRE3VGAvailable sinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK389
Plasmid#206791PurposeSp.dCas9, pTet.MCP-SoxS, J23119.gRNADepositorInsertsdCas9
MCP-SoxS
scRNA
UseTagsExpressionMutationPromoterJ23119 and TetAvailable sinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
UseTagsExpressionYeastMutationWTPromoterpGPDAvailable sinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorInsertPromoter of RRT8 (RRT8 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUB-GFP
Plasmid#11155PurposeMammalian expression vector for expression of GFP (Ubiquitin C promoter)DepositorUseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-ERT2CreERT2
Plasmid#149433Purposetamoxifen-inducible Cre recombinaseDepositorInsertERT2-Cre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-CreERT2
Plasmid#149434Purposetamoxifen-inducible Cre recombinaseDepositorInsertCre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pART (pT-2)
Plasmid#62708PurposeMammalian expression of tdTomato from the broadly active CAG promoter/enhancerDepositorInserttdTomato
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-FlpERT2
Plasmid#149435Purposetamoxifen-inducible Flp recombinaseDepositorInsertFlp-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE046 ZF43x12-C mKate2 (TUPV1)
Plasmid#138726PurposemMoClo TUPV, with ZF43x12-C promoter and mKate2 in the MCSDepositorInsertZF43x12-Compact
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterZF43x12-CompactAvailable sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT225_(pCA-tdT3Myc)
Plasmid#36873DepositorInserttdTomato-3Myc
UseTags3 Myc tagsExpressionMammalianMutationPromoterCAG (chicken beta actin promoter and CMV enhancer)Available sinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAQI (pT-1)
Plasmid#62707PurposeMammalian expression of tdTomato from the broadly active CAG promoter/enhancerDepositorInserttdTomato
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only