We narrowed to 13,467 results for: sequence
-
Plasmid#61424PurposesgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pCIBN(deltaNLS)-pmGFP
Plasmid#26867PurposeExpresses CIBN(1-170, -NLS)-eGFP-CaaX fusion for use in light-inducible protein interaction modules for targeting to the plasma membraneDepositorInsertCIBN(deltaNLS)-pmGFP (CIB1 Mustard Weed)
TagsEGFPExpressionMammalianMutationNLS sequences mutatedPromoterCMVAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pQE81L-KOFP7
Plasmid#160330PurposeThis plasmid encodes an engineered oxygen-independent flavin binding fluorescent protein with N-terminal 6xHis tag. Its quantum yield is comparable to EGFP.DepositorInsertKOFP7
Tags6xHis tagExpressionBacterialPromoterT5Available SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LifeAct-GFP-cytoB5RR
Plasmid#182577PurposeExpresses LifeAct-GFP targeted to the ER via the CytB5RR tail anchor sequenceDepositorInsertLifeAct-GFP-cytoB5RR
TagsLifeAct and cytoB5RRExpressionMammalianAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pTEF_Cas9
Plasmid#104909PurposehCas9 under control of Tef1 for direct cloning of HH-sgRNA-HDV PCR products and episomal expression in P. pastoris and G418 selectionDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
ER-B
Plasmid#209870PurposeDimerization dependent fluorescent protein B anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddGFP B
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
ER-GA
Plasmid#209871PurposeDimerization dependent fluorescent protein GA anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddGFP A
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FlipCherry-T2A-GFP
Plasmid#124436PurposeExpresses FlipCherry (TEV cleavage sequence) and T2A GFP in mammalian cellsDepositorInsertFlipCherry-T2A-GFP
ExpressionMammalianAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
ER-RA
Plasmid#209872PurposeDimerization dependent fluorescent protein RA anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddRFP A
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEC3115 (pSpy0K6-P23_mKate2~*ssrA)
Plasmid#218509Purposeintegrative plasmid enabling constitutive expression of mKate2 in Streptococcus pyogenes, integrates into the transcriptionally silent locus Spy_1078 via homologous recombinationDepositorInsertmKate2
TagsssrA degradation tagExpressionBacterialMutationDeletion of Plac_mrfp cassette, introduction of a…PromoterP23Available SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Mito-GA
Plasmid#209865PurposeDimerization dependent fluorescent protein GA anchored to cytosolic face of the mitochondrial membrane with C-terminal targeting sequence of human MAVSDepositorInsertddGFP A
TagsTargeting domain of MAVS RPSPGALWLQVAVTGVLVVTLLVV…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Fis1
Plasmid#182580PurposeExpresses mCherry targeted to the outer mitochondrial membrane via the Fis1 tail anchor sequenceDepositorInsertmCherry-Fis1
TagsFis1ExpressionMammalianAvailable SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-msfGFP
Plasmid#194913PurposeTetracycline inducible expression of msfGFP in StaphylococciDepositorInsertShine Dalgarno Sequence followed by monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV BiP-Myc-KDEL-wt
Plasmid#27164PurposeMammalian expression of human Bip with Myc tag near the C-terminus, retaining the C-terminal KDEL ER localization sequenceDepositorAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMVTNT-T7-KPNA1
Plasmid#26677DepositorInsertKaryopherin Alpha 1 (KPNA1 Human)
TagsT7ExpressionMammalianMutationKPNA1 sequence contains a reported SNP at S73NAvailable SinceNov. 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
Matrix-roGFP
Plasmid#49437PurposeExpresses thiol redox-sensitive ratiometric sensor roGFP in the mitochondrial matrix of mammalian cellsDepositorInsertMatrix-roGFP2
UseAdenoviralTagsCytochrome c oxidase subunit IV mitochondrial tar…ExpressionMammalianMutationC48S, Q80R, S147C, and Q204C in Clontech's G…PromoterCMVAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pME-Cas9-T2A-GFP
Plasmid#63155PurposeMiddle Entry clone for Gateway containing a zebrafish codon-optimized Cas9 flanked by 2 NLS and followed by inframe GFP. Cas9 and GFP are separated by the sequence of a T2A self-cleaving peptide.DepositorInsertCas9-T2A-GFP
UseCRISPR; Tol2 middle entry vector for gatewayAvailable SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Ace-mNeon2-Kv2.1PR
Plasmid#195528PurposeGreen fluorescent, negative response-polarity voltage indicator under the control of CaMKII promoter; soma-targetedDepositorInsertAce-mNeon2-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 81S; SY linkerPromoterCaMKIIAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZR158_Lenti-U6-gRNA-10xCS1-PP7_hPGK-PCP-P65-HSF1-Puro
Plasmid#180273PurposeLentiviral expression vector for CRISPRa-SAM sgRNA with 10x capture sequence, and PCP-P65-HSF1 cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only