We narrowed to 9,859 results for: REN
-
Plasmid#141575PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TFORF0311
Plasmid#141576PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0305
Plasmid#141573PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0303
Plasmid#141571PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0302
Plasmid#141570PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0300
Plasmid#141568PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0299
Plasmid#141567PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD-DiB1
Plasmid#168800PurposeFluorogen activating protein (FAP) DiB1DepositorInsertFluorogen activating protein DiB1
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-DiB3
Plasmid#168802PurposeFluorogen activating protein (FAP) DiB3DepositorInsertFluorogen activating protein DiB3
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
DT047A
Plasmid#159408PurposeConstitutive LuxR expression, controlled under T7 bacteriophage promoter, and inducible PFO-sfGFP chimeric protein expression, controlled under V. fischeri HSL-regulated pLux (luxPR) promoterDepositorInsertpr.T7-LuxR-pr.LuxR-sfGFP-PFO
UseSynthetic BiologyTagsFLAG/FLAGExpressionBacterialPromotertet and pLux promoterAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
DT033A
Plasmid#159394PurposeConstitutive murine mature BDNF expression, controlled under E.coli tac promoterDepositorInsertpr.tac-BDNF (Bdnf, Mouse) (Bdnf Mouse)
UseSynthetic BiologyTagsFLAGExpressionBacterialPromotertac promoterAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
p8116 LentiCRISPR v2 sgPTPN14-4
Plasmid#163316PurposeExpresses Cas9 and a human PTPN14-targeting control guide RNADepositorInsertsgPTPN14-4
UseCRISPR and LentiviralPromoterU6Available SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
p8208 MSCV-Neo C-HA EMPTY
Plasmid#163310PurposeEmpty vector controlDepositorTypeEmpty backboneUseRetroviralAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA
Plasmid#133345Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets blaA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_blaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pISH-Vmn2r76
Plasmid#108084PurposePreparation of RNA probe for ISH of mouse Vmn2r76 geneDepositorInsertVmn2r76 (Vmn2r76 Mouse)
UseIn vitro transcriptionAvailable SinceMay 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pISH-Olfr16
Plasmid#105486Purposeto generate a riboprobe for in situ hybridazationDepositorAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pISH-Olfr819
Plasmid#105492Purposeto generate a riboprobe for in situ hybridazationDepositorInsertOlfr819 (Olfr819 Mouse)
UseTo ganerate riboprobeAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pISH-Olfr545
Plasmid#105489Purposeto generate a riboprobe for in situ hybridazationDepositorInsertOlfr545 (Olfr545 Mouse)
UseTo ganerate riboprobeAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pISH-Olfr3
Plasmid#105487Purposeto generate a riboprobe for in situ hybridazationDepositorAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only