We narrowed to 9,843 results for: CAG
-
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMEF2c-AHF-DreERT2 (JDW 196)
Plasmid#242586PurposeThe Mef2c anterior heart field promoter driving expression of a tamoxifen inducible Dre recombinase.DepositorInsertDreERT2
ExpressionMammalianPromotermouse Mef2cAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3563)
Plasmid#239258PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-3xFlag-hGpr75-p.Ala110fs
Plasmid#236747PurposeExpress 3xFlag N-terminal tagged human GPR75 p.Ala110fs mutant transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorInsertGPR75 (GPR75 Human)
UseLentiviralTags3xFlagExpressionMammalianMutationAla110fs, deletion of GCCAGTAAvailable SinceJuly 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbSTM-5'UTR
Plasmid#231150PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbSTM-5?UTRDepositorInsertmobile gRNA targeting NbSTM-5?UTR
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shCavin1KDR-EGFP
Plasmid#187254PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-NT2
Plasmid#229848PurposeExpresses wild-type Cas9 and gRNA with non-target sequence.DepositorInsertguide RNA with non-target sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-hL1-gRNA2-EGFP
Plasmid#226003PurposeCRISPRi-KD of human LINE1DepositorInsertsgRNA targeting human L1HS
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DAZL_cterm2
Plasmid#222919PurposeCas9/sgRNA plasmid for targeting DAZLDepositorInsertCas9, DAZL sgRNA 2 (DAZL Human, Synthetic)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-CASK
Plasmid#221427PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertCASK (CASK Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
ph7SK-CDX2-gRNA
Plasmid#192513PurposeContains gRNA for CDX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-bleo-ErbB4
Plasmid#197353PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiPOLR2D
Plasmid#202445PurposeExpression of a CRISPRi guide targeting POLR2DDepositorAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-RPE_sgRNA2
Plasmid#201619PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertRPE (RPE Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-shBIRC6-2-C911
Plasmid#202450Purposea seed-matched control for pRSITEP-puro-shBIRC6-2DepositorAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UCK1_sgRNA2
Plasmid#201631PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUCK1 (UCK1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-Csy4
Plasmid#161760PurposeMODULE B Csy4 vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2103 - #91061)DepositorInsertgRNAs
ExpressionBacterialPromoterCmYLCV PromoterAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
TBPL1 KO 2
Plasmid#200211PurposegRNA for TBPL1 KODepositorAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only