We narrowed to 28,460 results for: CAL
-
Plasmid#224059PurposeAiE1037m is an enhancer sequence, designed to drive AAV-mediated transgene expression in cortical L5_ET neuronsDepositorInsertSYFP2-P2A-3XFLAG-10aa-H2B
UseAAVMutationNAPromoterminBGAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP12371 - pAAV-AiE0532h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2371)
Plasmid#224057PurposeAiE0532h is an enhancer sequence, designed to drive AAV-mediated transgene expression in cortical Sst+ neurons (note BNST)DepositorInsertSYFP2
UseAAVMutationNAPromoterminBGAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pemiRFP670-N1
Plasmid#136556PurposeA cytoplasmic expression of a monomeric phytochrome-based near-infrared fluorescent protein emiRFP670 (enhanced miRFP670)DepositorInsertemiRFP670
ExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAS9counter
Plasmid#107192PurposeExpresses CAS9 and sgRNA for targeted counterselection in S. aureusDepositorInsertsCas9
sgRNA
ExpressionBacterialPromoterprab17Available SinceFeb. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-PB-PGK-tetR-KRAB-2A-Puro
Plasmid#129536PurposePiggyBac transposon carrying tetR-KRAB-2A-Puro under the PGK promoter.DepositorInsertPB-PGK-tetR-KRAB-2A-Puro
UseUnspecifiedPromoterhPGK promoterAvailable SinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
KillerOrange /pQE-30
Plasmid#74748PurposeKillerOrange gene for bacterial expressionDepositorInsertKillerOrange
TagsHisTagExpressionBacterialMutationKillerRed with substitutions G3C Y66W D113S N145S…PromoterT5Available SinceAug. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
yHS1
Plasmid#159150PurposeCytosolic labile heme reporterDepositorInsertyHS1
ExpressionYeastPromoterGPDAvailable SinceSept. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJL361
Plasmid#243714PurposeA piggyBac vector containing a synthetic reporter containing the 5' and 3' UTRs of COX7A2 flanking a partial mCherry sequence with an intronDepositorInsert5' and 3' UTRs of COX7A2 flanking a partial mCherry sequence with an intron
ExpressionMammalianAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
XZ374 EF1a-IL2Rgsp-3xHA-IL2Rg(ECD+TM)-TS-tdMCP-export
Plasmid#233389PurposeOptimized IL-2-sensing eLIDAR with IL-2 gamma chain ecto+TM domains fused with tdMCP, with Golgi traffic sequence and ER export sequenceDepositorInsertIL2Rg(ecto+TM)-tdMCP
TagsHAExpressionMammalianMutationWTPromoterEF1aAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTALdNC-AAVS1_T1
Plasmid#80495PurposeAAVS1 TALEN expression vector (Left)DepositorInsertAAVS1 TALEN (Left)
UseGateway entryPromoternoneAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTALdNC-AAVS1_T2
Plasmid#80496PurposeAAVS1 TALEN expression vector (Right)DepositorInsertAAVS1 TALEN (Right)
UseGateway entryPromoternoneAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
Orai1 CFP
Plasmid#19757DepositorAvailable SinceNov. 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro FLAG SREBP2
Plasmid#32018DepositorAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_cAMPFIRE-H
Plasmid#182281PurposeMammalian expression of the cAMP sensor cAMPFIRE-H under a CMV promotor.DepositorInsertcAMPFIRE-H (cAMP sensor)
ExpressionMammalianAvailable SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Halo-DNAPKcs HRD
Plasmid#207088PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous DNA-PKcs locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human DNAPKcs locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT39
Plasmid#223411PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants select.DepositorInsert2x35s-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast
Plasmid#26655Purpose3rd gen lentiviral backbone for cloning and expression of new shRNA sequences. Uses blasticidin for selection.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral and RNAiExpressionMammalianAvailable SinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/HF-CDC50A
Plasmid#209223PurposeMammalian expression of CDC50ADepositorAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQadd1F
Plasmid#135660PurposeClostridial vector, encoding a targetron carrying two lox511/71 and loxFAS/66 sites in tandem in the forward (sense) orientation. Retarget intron to insert double-lox site onto genome at desired site.DepositorInsertIntron containing lox site
UseCre/LoxExpressionBacterialPromoterpFerAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only