We narrowed to 19,678 results for: cat
-
Plasmid#214924PurposeYeast expression vector 6xHisTag-TEV at N terminus to express S cerevisiae topoisomerase II (1–1177)DepositorInserttopoisomerase II
Tags6x His-TEVExpressionYeastMutationDeleted amino acids 1178-1428PromoterGal 1/10Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+pPGI+NAT+tNOS+ku70 insD (SBE217)
Plasmid#195049Purposeintegration cassette for ku70 deletion and expression of NAT gene under pPGI for characterizationDepositorInsertNAT
ExpressionBacterialPromoterpPGIAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA15-Ubc-NLS- scFV-tdTomato
Plasmid#199446PurposeExpression of scFV-tdTomato that binds to the GCN4 peptide from the SunTag System in mammalian cellsDepositorInsertscFV-tdTomato
UseLentiviralExpressionMammalianPromoterhuman ubiquitin C (UBC)Available sinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAL1
Plasmid#197285PurposeShuttle plasmid that replicates in E. coli, S. cerevisiae, and A. laidlawii. Contains the OriC from A. laidlawii 8195DepositorInsertOrigin of replication of A. laidlawii 8195: whole dnaA gene, plus upstream and downstream intergenic regions
UseSynthetic Biology; Bacterial and yeast cloningAvailable sinceApril 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-AP3
Plasmid#190826PurposeFor mammalian expression of AP3, the RNA aptamer of GFP. Expression is driven by a U6 promoter.DepositorInsertAP3 (an RNA aptamer of GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available sinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEasyG1_zeo
Plasmid#184910PurposeTemplate to generate via PCR a single gRNA for expression in S. cerevisiaeDepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
HiFi dCas9 KRAB
Plasmid#188500PurposeExpresses FLAG tagged HiFi dCas9 KRABDepositorInsertdCas9
UseCRISPR and LentiviralExpressionMammalianMutationD10A/R691A/H840APromoterEF1aAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDF0582 huDisCas7-11 R1045-GGGS-R1122 U6-NT guide
Plasmid#186991PurposeAAV transgene plasmid for Cas7-11-R1045-GGGS-R1122, with U6 promoter-driven expression of non-targeting crRNA guideDepositorInsertcas7-11-r1045-gggs-r1122, non-targeting crRNA guide
UseAAVMutationr1045-gggs-r1122 deletionAvailable sinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINER5
Plasmid#185895PurposeIn vivo gene amplification (HapAmp) of nerolidol synthetic module at RPL25 locus (15 copy).DepositorInsertPRPL25(Arm1)>Kl.LEU2>TKl.LEU2-PGAL1>ERG20>TRPL3-TRPL25(Arm3)-ARS305-PSk.GAL2>YFAST-EVBR1.2A-AcNES1>TRPL41B-PPDA1>RPL25(part;Arm2
ExpressionYeastMutationNoneAvailable sinceAug. 25, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSIN-Arkadia-gRNA1
Plasmid#180374Purposetargeting mouse Arkadia geneDepositorAvailable sinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH6HTC_BTF3-Halo
Plasmid#175324PurposeProduction of HaloTag fusion proteinDepositorPublicationAvailable sinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_U6_sgRNA_Mettl3C
Plasmid#165420PurposesgRNA construct for targeting Mettl3 C-terminusDepositorAvailable sinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.FLAG.VSVg_NGFR
Plasmid#158345PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.NWS.VSVg_NGFR
Plasmid#158348PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.NWS.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.V5_NGFR
Plasmid#158248PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.V5MutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.FLAG_NGFR
Plasmid#158249PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.FLAG.VSVg_NGFR
Plasmid#158233PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
874V=βTub-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159672PurposePlasmid supports Cas9 expression only in males, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertβTub-NLS-hSpCas9-T2A-GFP
TagsT2A-GFPExpressionInsectAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR 3UTR
Plasmid#110412PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-AVI
Plasmid#160477PurposeExpresses SARS-CoV-2 RBD-SD1 domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1
TagsAVI, HRV3C, and scFcExpressionMammalianAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only