We narrowed to 10,405 results for: chloramphenicol
-
Plasmid#186403PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter ECFP under control of the pFOG ectodermal regulatory sequence.DepositorPublicationTypeEmpty backboneUseGateway CloningAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pDEST-pSP172BSSPE-Swa1::RfA-ECFP
Plasmid#186402PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter eCFP under control of a reg. sequence in the Swa1 restriction site.DepositorPublicationTypeEmpty backboneUseGateway CloningAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::RfA-venus
Plasmid#186401PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter Venus under control of the pFOG ectodermal regulatory sequence.DepositorPublicationTypeEmpty backboneUseGateway CloningAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::venus-RfA
Plasmid#186400PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of the pFOG ectodermal regulatory sequence.DepositorPublicationTypeEmpty backboneUseGateway CloningAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::venus-RfA
Plasmid#186398PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of a reg. sequence in the Swa1 restriction site.DepositorPublicationTypeEmpty backboneUseGateway CloningAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::RfA
Plasmid#186397PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned gene of interest under control of the pFOG ectodermal regulatory sequence.DepositorPublicationTypeEmpty backboneUseGateway CloningAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA
Plasmid#186396PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned gene of interest under control of a regulatory sequence cloned in the Swa1 restriction site.DepositorPublicationTypeEmpty backboneUseGateway CloningAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Spe3-RfA-HA
Plasmid#186374PurposeDestination vector for the expression of a fusion of an N-ter protein of interest with an HA tag into embryos, by mRNA microinjectionDepositorPublicationTypeEmpty backboneUseGateway CloningAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Spe3-HA-RfA
Plasmid#186373PurposeDestination vector for the expression of a fusion of N-ter HA tag and a protein of interest into embryos, by mRNA microinjectionDepositorPublicationTypeEmpty backboneUseGateway CloningAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Spe3-Venus-RfA
Plasmid#186371PurposeDestination vector for the expression of a fluorescent fusion of N-ter Venus and a protein of interest into embryos, by mRNA microinjectionDepositorPublicationTypeEmpty backboneUseGateway CloningAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD33(A-H*HA-N)
Plasmid#187086PurposeMedium expression of Complex I with subunits N and H -HA taggedDepositorInsertnuoA-N
TagsHA tags nuoN, nuoHExpressionBacterialAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSBK.136
Plasmid#187220PurposeExpresses Eco1 ncRNA v35 (long a1/a2) and Eco1 ncRNA v35 (long a1/a2, barcode 6) from promoters pSalTTC and pTet*, respectivelyDepositorInsertRetron Eco1 ncRNA v35 (long a1/a2); Retron Eco1 ncRNA v35 (long a1/a2, barcode 6)
ExpressionBacterialPromoterA: pSalTTC; B: pTet*Available sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_139
Plasmid#180565PurposeSpacer sequence in D1.1 format. Allows for Level 2 cloning with D1.2DepositorInsertSpacer sequence in D1.1 format. Allows for Level 2 cloning with D1.2
ExpressionBacterialAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Avs4_Chimera
Plasmid#188802PurposeChimeric Avs4 with transmembrane effectorDepositorInsertAvs4 chimera
ExpressionBacterialPromoterEcAvs4 native promoterAvailable sinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB166
Plasmid#101668PurposeOpto-T7RNAP*(563-F2), half expr.DepositorInsertOpto-T7RNAP*(563-F2), half expr.
UseSynthetic BiologyExpressionBacterialAvailable sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB174
Plasmid#101673PurposeOpto-T7RNAP*(179)DepositorInsertOpto-T7RNAP*(179)
UseSynthetic BiologyExpressionBacterialAvailable sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB144
Plasmid#101665PurposeOpto-T7RNAP*(69)DepositorInsertOpto-T7RNAP*(69)
UseSynthetic BiologyExpressionBacterialAvailable sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB153
Plasmid#101664PurposeOpto-T7RNAP*(600)DepositorInsertOpto-T7RNAP*(600)
UseSynthetic BiologyExpressionBacterialAvailable sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB171
Plasmid#101670PurposeOpto-T7RNAP*(69), equal expr.DepositorInsertOpto-T7RNAP*(69), equal expr.
UseSynthetic BiologyExpressionBacterialAvailable sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only