We narrowed to 9,732 results for: bli
-
Plasmid#225930PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with the K-Ras6R membrane localisation signalDepositorInsertmScarlet3-KRas6R
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
10_T7-SP-CD8tm-mScarlet3
Plasmid#225937PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with a signal peptide and the CD8 transmembrane domainDepositorInsertSP-CD8tm-mScarlet3
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS423-mitoT
Plasmid#174525PurposeExpresses yeast variant of mitoT synthetic intermembrane tether bridging the inner and outer mitochondrial membranesDepositorInsertYeast mitochondrial intermembrane tether
UseSynthetic BiologyTagseGFPExpressionYeastPromoterMET25Available SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI stuffer A-tract
Plasmid#138525PurposeExpresses a guide RNA of choice cloned into the BfuI site extended at the 3' end to incorporate a 220-nt control A-tract repeat RNA sequence.DepositorInsertControl non-PRC2 binding A-tract repeat RNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET21-10XHis-GST-HRV-Her2-dL5-Her2
Plasmid#85624PurposeBacterial expression vector for Z342-dL5(E52D)-Z342 affibody fusion protein (AFA) with N-terminal His10, GST and HRV3C cleavage site (MBIC5, dL5**, FAP, AffiFAP)DepositorInsert10XHis-GST-HRV-Her2-dL5-Her2 (EGFR Human, Schistosoma japonicum, Synthetic)
Tags10XHis-GST-HRV and The Her2 Affibody and dL5 FAP …ExpressionBacterialMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterT7Available SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Linked Free PcPTS
Plasmid#182486PurposeYeast integrative plasmid for expressing fusion protein ERG20-PcPTS, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertFPPS-PTS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI stuffer G-tract
Plasmid#138524PurposeExpresses a guide RNA of choice cloned into the BfuI site extended at the 3' end to incorporate a 220-nt PRC2-binding G-tract repeat RNA sequence.DepositorInsertPRC2-binding G-tract repeat RNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hGLIS1GR
Plasmid#59312PurposeForced expression of human GLIS1GRDepositorInsertGLIS1 (GLIS1 Human)
UseRetroviralTagscGR - hormone binding domain of glucocorticoid re…ExpressionMammalianAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFP
Plasmid#166676PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertsVP2C-GFP
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
LP344
Plasmid#90174PurposepEGFP-C1 with cDNA encoding HsKIF13B aa residues 1-370DepositorAvailable SinceMay 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
LP241
Plasmid#90173PurposepEGFP-N1 with cDNA encoding HsKIF13B aa residues 1-557DepositorAvailable SinceMay 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
LP346
Plasmid#90175PurposepEGFP-C1 with cDNA encoding HsKIF13B aa residues 1-1000DepositorAvailable SinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
tetO-Mex3a_HyperTRIBE-adar_deaminase-V5-t2a-mCherry
Plasmid#241315Purposeinducible Mex3a fused to mouse Adar Deaminase domain (HyperTRIBE) and V5 with t2a mCherry for expression in mammalian cellsDepositorTagsAdar_deaminase_domain and V5ExpressionMammalianMutationE957QPromotertetO and CMVAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET Assay Vector, BiBRET CRAF-BRAF
Plasmid#238574PurposeExpress CRAF-BRAF Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV TRE-Tight CheRiff-mKate2
Plasmid#182493PurposeExpression of CheRiff channelrhodopsin linked to mKate2 from a Tet-inducible promoterDepositorInsertCheRiff (#51697 Adam Cohen Lab)
UseAAVTagsmKate2 (Evrogen)ExpressionMammalianPromoterTRE-Tight (Clontech)Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-hIRF5-V5(4D)-LPETG
Plasmid#237225PurposeExpresses LPETG-tagged, constitutively active human IRF5 variant in bacteriaDepositorInsertInterferon regulatory factor 5 (IRF5 Human)
Tags6xHisExpressionBacterialMutationS451D, S453D, S456D, S462DAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
LgBiT-CALM1/SmBiT-ADCY8 BiBiT Vector
Plasmid#237114PurposeExpress LgBiT-CALM1/SmBiT-ADCY8 Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsLgBiT and SmBiTExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits