We narrowed to 1,679 results for: αGFP
-
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only
-
GFP(N-glyc)-Tac-TC
Plasmid#162496PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in the N-terminus in mammalian cells, and there is one N-glycosylation site in GFP tag.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 TCF3
Plasmid#67110PurposeStandard for cell-free expression benchmarking.DepositorInsertTCF3 (TCF3 Human)
UseCell-free expressionTagsEGFP and HisMutationTruncated isoformPromoterT7Available sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRB2963
Plasmid#8678DepositorAvailable sinceJune 30, 2005AvailabilityAcademic Institutions and Nonprofits only -
pHNF4A-Enh_Gsta2-IRES2-H2BeGFP
Plasmid#247049PurposeThis plasmid was employed to generate the mouse model used in this study. It contains the human HNF4A gene enhancer linked to the Shh mini-promoter and the Gsta2-IRES2-H2BeGFP. Homologous armDepositorInsertGlutathione S-Transferase Alpha 2 (Gsta2 Mouse)
ExpressionMammalianAvailable sinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_H0-ABD+
Plasmid#234552PurposeCTNNA1 enhanced-actin-binding domain mutationsDepositorInsertmEGFP:hCTNNA1_H0-ABD+ (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationR666G, A667S, I668G, M669SPromoterCMVAvailable sinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_WT-ABD
Plasmid#234553PurposeCTNNA1 M-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa 273-635PromoterCMVAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_E307K
Plasmid#234560PurposeCTNNA1 butterfly eye mutantDepositorAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_R551A
Plasmid#234558PurposeCTNNA1 M2-M3 salt-bridge disrupting mutantDepositorAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS406-PHO5-GFP-CERT PH domain
Plasmid#58725PurposeExpresses GFP-Tagged CERT PH domain in yeastDepositorInsertcollagen, type IV, alpha 3 binding protein PH domain (CERT1 Human)
TagsGFP and MycExpressionYeastPromoterPHO5Available sinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hACE2-hygro
Plasmid#161758PurposeExpresses human ACE2 in mammalian cellsDepositorAvailable sinceNov. 5, 2020AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
APP_pcDNA6.2/EmGFP-Bsd
Plasmid#176954PurposeMammalian expression vector encoding APP and EmGFP-BsdDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAPP (APP Human)
ExpressionMammalianPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-TC
Plasmid#162492PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FLAG-mPar6a WT
Plasmid#86148PurposeFLAG tagged mouse Par6 wild type - Binds to aPKC, Par3, Lgl, Cdc42DepositorAvailable sinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mouse aB crystallin 1.5kb promoter/AcGFP
Plasmid#98104PurposeMouse aB crystallin 1.5kb promoter segment driving GFP expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAlpha B-crystallin promoter 1.5 kb fragment, Mus musculus (Cryab Mouse)
UseGfp expressingTagsGFPPromoterAlpha B-crystallin 1.5 kb promoter fragment (-150…Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Venus-Puma-pEGFP-C1
Plasmid#166739PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, PumaDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPuma (BBC3 Human)
TagsVenusExpressionMammalianPromoterCMVAvailable sinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Mouse aB crystallin 250bp promoter/AcGFP
Plasmid#98102PurposeMouse aB crystallin 250bp promoter segment driving GFP expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAlpha B-crystallin promoter 250 bp fragment, Mus musculus (Cryab Mouse)
UseGfp expressingTagsGFPPromoterAlpha B-crystallin promoter 250 bp fragment (-259…Available sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_P-linker 4E
Plasmid#234564PurposeCTNNA1 Phospholinker phospho-mimicDepositorInsertmEGFP:hCTNNA1_P-linker 4E (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationS641E, S652E, S655E, T658EPromoterCMVAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_P-linker 4A
Plasmid#234563PurposeCTNNA1 Phospholinker phospho-mutantDepositorInsertmEGFP:hCTNNA1_P-linker 4A (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationS641A, S652A, S655A, T658APromoterCMVAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM2,3-domain
Plasmid#234556PurposeCTNNA1 M2,3-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM2,3-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa 397-509PromoterCMVAvailable sinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only