We narrowed to 17,803 results for: ERG
-
Plasmid#67880Purposeexpresses dsRed and shRNA to knock down adra2a receptorsDepositorInsertdsRed and shRNA to knock down the mouse adra2 receptor
UseAAVTagsExpressionMammalianMutationPromoterchicken beta actinAvailable sinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone2
Plasmid#162129PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone1
Plasmid#162128PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Cdx2
Plasmid#70697PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Cdx2DepositorInsertCdx2 (Cdx2 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromotertetOAvailable sinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFC902
Plasmid#106904PurposeThe vector has a U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA-Gly repeat; and a gene encoding cas9 controlled by Ptef1 and Ttef1DepositorInsertscas9
pyrG
U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-HMGB1
Plasmid#31208DepositorInsertHMGB1 (HMGB1 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailable sinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-MCM7
Plasmid#31212DepositorInsertMCM7 (MCM7 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailable sinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Gata3
Plasmid#70270PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Gata3DepositorInsertGATA binding protein 3 (Gata3 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromotertetOAvailable sinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Ascl2
Plasmid#71151PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ascl2/Mash2DepositorInsertAscl2 (Ascl2 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromotertetOAvailable sinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Ets2
Plasmid#70272PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ets2DepositorInsertEts2 (Ets2 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromotertetOAvailable sinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4
Plasmid#170855PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-DEST-ANLN
Plasmid#31203DepositorInsertANLN (ANLN Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailable sinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5
Plasmid#170856PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-GCaMP6f
Plasmid#178728PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6
Plasmid#170857PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone1
Plasmid#162122PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag MFF iso2 S172A
Plasmid#74392PurposeFlag tagged human S172A MFF isoform 2 mutantDepositorInsertFlag-MFF (MFF Human)
UseTagsFlagExpressionMammalianMutationSer 172 Ala (numbering based on MFF isoform 1)PromoterAvailable sinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-GFP
Plasmid#178713PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-dTom
Plasmid#178715PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertdTom
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only