We narrowed to 2,927 results for: PREP;
-
Plasmid#240223PurposeGateway entry clone with ER-localized TurboID tagged with superfolder GFP (contains stop codon)DepositorInsertBIP-sfGFP-TurboID-KDEL
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3G1S+4V
Plasmid#234612PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 Gly and 1 Ser mutated to AsnDepositorInserthnRNPA1_LCD_4GSV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationG204V, S231V, G274V, G303VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED solvvol
Plasmid#232958PurposeGalactose iduced expression of Gcn4 LVtoED solvvol in yeastDepositorInsertGcn4 ILVtoED solvvol
TagsTEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD 5W D262V
Plasmid#234617PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262V with partial W mutantDepositorInserthnRNPA1_LCD_5W D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationF222W, F228W, Y237W, D262V, Y305W, F320WPromoterT7Available SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TMEM16F-I521A-peGFP-N1
Plasmid#228577PurposeExpresses mouse TMEM16F-I521A-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521A plus a 3 amino acid N-terminal truncation (…Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TMEM16F-I521E-peGFP-N1
Plasmid#228578PurposeExpresses mouse TMEM16F-I521E-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521E plus a 3 amino acid N-terminal truncation (…Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-DXO
Plasmid#177993PurposeFor purification of N-terminally His-tagged DXO from bacteriaDepositorAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-EED-2A-mTurquoise
Plasmid#225692PurposeLentiviral expression of rTetR(SE) fused to EED and mTurquoise-NLSDepositorInsertrTetR-EED (EED Synthetic, Human)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-HP1a-2A-mTurquoise
Plasmid#225691PurposeLentiviral expression of rTetR(SE) fused to HP1a and mTurquoise-NLSDepositorInsertHP1a (CBX5 Synthetic, Human)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET3a.H2B-K120C
Plasmid#224706PurposeExpresses Human H2B K120C mutant in bacterial cells for fluorescent labelling of histone octamersDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-LCB3_v1.2-PDGFR-T2A-mCherry (pZYW049)
Plasmid#194232PurposeLentiviral expression vector expressing LCB3 on the cell surface attached to PDGFR's transmembrane domain and mCherry transduction markerDepositorInsertEF1a-LCB3-PDGFR TMD-T2A-mCherry
UseLentiviralPromoterEF1aAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
prhaBAD-anti-mouse-Nb-Hia5
Plasmid#239626PurposeRhamnose inducible expression plasmid for anti-mouse nanobody fusion to Hia5 DNA adenine methyltransferaseDepositorInsertHia5
Tags6HIS, MBP, TEV, and anti-Mouse NanobodyExpressionBacterialMutationCodon optimized for bacterial expressionPromoterrhaBADAvailable SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-myc-YAP5SA-puro
Plasmid#249725PurposeDoxycycline-inducible expression of myc epitope-tagged YAP5SA with puro selectionDepositorInsertYAP5SA (YAP1 Human)
UseLentiviralTagsMycExpressionMammalianMutationS61A, S109A, S127A, S164A, S381A (phosphorylation…PromoterTet ONAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1-FLAG-IRES-eGFP
Plasmid#234619PurposeMammalian expression of full-length hnRNPA1 with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorInserthnRNPA1 (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationC-terminal FLAG tag, co-expressing with eGFP via …PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
YY206: pAAV_hSyn::GEMINI(B)-p2A-GEMINI(A)_UbC::HaloTag-GEMINI(A)
Plasmid#228886PurposeAAV plasmid expressing the two GEMINI building blocks (A and B) in an equimolar ratio under the control of a hSyn promoter, and HaloTag-GEMINI(A) under the control of a UbC promoter.DepositorInsertGEMINI(A); GEMINI(B); HaloTag-GEMINI(A)
UseAAVTagsHaloTagExpressionMammalianPromoterhSyn; UbcAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Anti-amyloid-β 40/42 nanobody (R3VQ) with sortase tag
Plasmid#233217PurposeMammalian epression of anti-amyloid-β 40/42 nanobody (R3VQ) with a sortase tag for direct dye conjugation.DepositorInsertAnti-amyloid-β 40/42 nanobody (R3VQ)
TagsSortase tag, His tagExpressionMammalianAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
JL054: pPB_NFκB::GFP-GEMINI(A)-P1N4_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228884PurposePiggyBac plasmid expressing the destabilized GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-PinkyCaMP
Plasmid#232856PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under hSyn promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterhSynAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only