We narrowed to 11,874 results for: KIN
-
Pooled Library#207480PurposeHA-GD2-28z CAR in combination with ~10,000 transcription factor combinations (and related proteins) and controls (GFP/RFP combinations). Library can be used to generate HDR templates for modular pooleDepositorUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pCDF_AtRaf1/Raf2/RbcX2/BSD2/RbcX1
Plasmid#229510PurposeExpresses Arabidopsis thaliana chaperones: Raf1,Raf2,RbcX2,BSD2,RbcX1DepositorInsertsExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), N229A (EcQ) MetNIQ in pBAD
Plasmid#118581PurposeN295A Mutation of MetN in Methionine ABC Transporter and N229A Mutation in Methionine Binding Protein (MetQ) for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Asparagine (Asn) 229 to Alanine (Ala) and…PromoterNone and araBAD PromotoerAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
plIG-123_HA-GD2-28z_CAR_TF_Library
Pooled Library#207478PurposeHA-GD2-28z CAR in combination with 100 transcription factors (and related proteins) and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into thDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), Y160A (EcI) MetNIQ in pBAD
Plasmid#118260PurposeN295A Mutation of MetN and Y160A in MetI in Methionine ABC Transporter for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala) …PromoterNone and araBAD PromoterAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJTB126
Plasmid#248910Purposeexpresses the yeast analog-sensitive Smk1-Q120A and Ssp2 fused to glutathione-S-transferase in bacteriaDepositorInsertsSMK1 Mitogen-activated Protein Kinase -analog-sensitive form (SMK1 Budding Yeast, Sequence is from the SK1 isolate of S. cerevisiae and will differ by 1 non-synonomous/several synonymous changes from S288C form)
Ssp2 Activator of the Smk1 MAPK (SSP2 Sequence is from the SK1 isolate of S. cerevisiae and may differ by synonymous changes from S288C form, Budding Yeast)
Tagsglutathione-S-transferaseExpressionBacterialMutationcodon 120 has been changed from Q to A (Smk1-Q120…PromoterT7Available SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
RCAS.Sfi Akt1-K179M
Plasmid#196375PurposeAkt1 kinase negative mutant K179M in avian expression vectorDepositorInsertc-akt1 K179M
UseRetroviral; AvianTagsHAAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHALgMT
Plasmid#234792PurposeMammalian expression of yeast OMP25DepositorInsertOMP25
TagsLgBiTExpressionMammalianAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCCI-YFVΔCME-mScarlet
Plasmid#233589PurposepCCI vector encoding YFV-17D lacking C, prM, E but with mScarletDepositorInsertYFV-17D lacking C, prM, E but with mScarlet
UseTransneural tracingMutationLacking C, prM, and EPromoterSP6Available SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
CSII-mApple
Plasmid#207350PurposeMammalian expression of mAppleDepositorInsertmApple
ExpressionMammalianAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG.mCherry-INBox-eDHFR
Plasmid#176202PurposeSingle INBox (INCENP 819-918) recruitment responsible for targeted Aurora B activation and recruitment using TMP-Halo dimerization systemDepositorInsertmCherry-INBox-eDHFR
ExpressionMammalianAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCI-YFVΔCMENS1-Flpo
Plasmid#233592PurposepCCI vector encoding YFV-17D lacking C, prM, E and NS1 proteins but with FlpoDepositorInsertYFV-17D lacking C, prM, E and NS1 proteins but with Flpo
UseTransneural tracingMutationLacking C, prM, E and NS1PromoterSP6Available SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV hSyn mRuby
Plasmid#220912PurposeNeuronal specific expression of mRubyDepositorInsertmRuby
UseAAVExpressionMammalianPromoterhSynAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 - TRC mTagBFP2-Synapsin1a
Plasmid#191567PurposeExpresses an shRNA and mTagBFP2-synapsin1aDepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianPromoterU6 for shRNAAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Unc104_K560GFP
Plasmid#129773PurposeExpresses worm Kinesin-3 Unc104 head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertUnc104 (unc-104 Nematode)
TagsGFP and His6ExpressionBacterialMutationTruncation at 361, fused to kinesin-1 starting Al…Available SinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a_Pro-IL-18_sheep
Plasmid#214335PurposeProtein overexpression in bacteriaDepositorInsertIL18
TagsHis-TEV and MycExpressionBacterialPromoterT7Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only