We narrowed to 8,725 results for: PAN
-
Plasmid#183503PurposeLentiviral vector expressing a doxycycline-inducible constitutively active truncated androgen receptor (wild type AR)DepositorInsertAndrogen receptor (AR Human)
UseLentiviralExpressionMammalianMutationConstitutively active truncated AR; spans AR 1-70…PromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_B.1.1.248
Plasmid#172737PurposeExpression vector for SARS-CoV-2 (B.1.1.248) spike used in the Spike Display systemDepositorInsertSARS-CoV-2 S B.1.1.248 (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 18, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Anti-Shank2 [N23B/6-rat IgG2a] - Chimeric
Plasmid#227078PurposeMammalian expression plasmid of anti-Shank2 (Rattus norvegicus) rat IgG2a R-mAb. Derived from hybridoma N23B/6.DepositorInsertAnti-Shank2 (Rattus norvegicus) recombinant mouse monoclonal antibody. (Shank2 Chimera: M. musculus (mouse)/R. norvegicus (rat))
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRM56 tet-AR(1-707)C617Y
Plasmid#183504PurposeLentiviral vector expressing a doxycycline-inducible truncated DNA-binding mutant androgen receptor (AR mutant C617Y)DepositorInsertAndrogen receptor (AR Human)
UseLentiviralExpressionMammalianMutationTruncated mutant AR; spans AR 1-707 aa, and conta…PromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-V16D-FLAGC
Plasmid#184500PurposeExpresses the V16D mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInsert17-beta-hydroxysteroid dehydrogenase 11 (HSD17B11 Human)
TagsFLAGC-GFPExpressionMammalianMutationV16DPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-L14P-FLAGC
Plasmid#184499PurposeExpresses the L14P mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInsert17-beta-hydroxysteroid dehydrogenase 11 (HSD17B11 Human)
TagsFLAGC-GFPExpressionMammalianMutationL14PPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-S172L-FLAGC
Plasmid#161904PurposeExpresses the catalytically inactive S172L mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInserthydroxysteroid 17-beta dehydrogenase 11 (HSD17B11 Human)
TagsFLAG-GFPExpressionMammalianMutationS172L; catalytically dead mutantPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)
Plasmid#217340PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PermaPhos Kit
Plasmid Kit#1000000226PurposeThis kit is used for expressing recombinant proteins with site-specific, non-hydrolyzable phosphoserine (nhpSer) in an engineered self-sufficient E. coli genetic code expansion (GCE) expression systemDepositorAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
AdenoBuilder toolkit
Plasmid Kit#1000000176PurposePlasmids containing modular inserts that span the human adenovirus serotype 5 (HAdV5) genome that can be assembled in a one-tube reaction.DepositorAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
AID* Kit
Plasmid Kit#1000000120PurposeExpanded tool kit for the auxin-inducible degron (AID) system in yeast ( S. cerevisiae). Includes tags for easy detection by antibodies/microscopy and a set of selection markers.DepositorAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP14019 - pAAV-hSyn1-mTFP1-10aa-H2B-WPRE3-BGHpA (Alias: CN4019)
Plasmid#229937PurposeAAV vector for pan-neuronal expression of nuclear mTFP1DepositorInsertmTFP1-10aa-H2B
UseAAVAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP15324 - pAAV-hSyn1-mScarlet-10aa-H2B-WPRE3-BGHpA (Alias: CN5324)
Plasmid#229938PurposeAAV vector for pan-neuronal expression of nuclear mScarletDepositorInsertmScarlet-10aa-H2B
UseAAVAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP14292 - pAAV-AiE1123m-minBG-SYFP2-P2A-3XFLAG-10aa-H2B-WPRE3-BGHpA (Alias: CN4292)
Plasmid#224042PurposeAiE1123m is an enhancer sequence, designed to drive AAV-mediated transgene expression in pan-neuronalDepositorInsertSYFP2-P2A-3XFLAG-10aa-H2B
UseAAVMutationNAPromoterminBGAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Target Accelerator Lung Cancer Mutant Collection
Plasmid Kit#1000000104PurposePanel of lung adenocarcinoma alleles that have undergone basic, functional screening; full-length human clones (180 mutant and 45 corresponding wild-type) and 82 wild-type experssion controlsDepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Antibody#240999-rAbPurposeAnti-Glypican 4 (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes mouse and human GPC4. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#241001-rAbPurposeAnti-Glypican 6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse GPC6. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#240996-rAbPurposeAnti-Glypican 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse GPC1. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits